Morpholino

MO1-cntn2

ID

ZDB-MRPHLNO-051128-5

Name

MO1-cntn2

Previous Names

TAGMO1 (1)

Target

cntn2 (1)

Sequence

5' - CCACACCCAGACCAGACACTTATTT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

A translation blocking morpholino.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-cntn2

Expressed Gene	Anatomy	Figures
cntn2	facial nerve motor nucleus motor neuron	Fig. 7 from Sittaramane et al., 2009
egr2b	rhombomere 3 rhombomere 5	Fig. 4 from Sittaramane et al., 2009
th	locus coeruleus	Fig. 4 from Sittaramane et al., 2009

Phenotype

Phenotype resulting from MO1-cntn2

Phenotype	Fish	Figures
axon guidance disrupted, abnormal	zy8Tg + MO1-cntn2	Fig. 3 , Fig. 4 , Fig. 5 from Wolman et al., 2008
axonogenesis neotenous growth, abnormal	zy8Tg + MO1-cntn2	Fig. 3 , Fig. 6 from Wolman et al., 2008
branchiomotor neuron neuron migration decreased occurrence, abnormal	rw0Tg + MO1-cntn2	Fig. 2 , Fig. 5 from Gurung et al., 2018
facial nerve motor nucleus motor neuron mislocalised, abnormal	rw0Tg + MO1-cntn2	Fig. 2 , Fig. 3 , Fig. 4 , Fig. 5 , Fig. 7 from Sittaramane et al., 2009
medial longitudinal fasciculus morphology, abnormal	zy8Tg + MO1-cntn2	Fig. 3 , Fig. 4 from Wolman et al., 2008
medial longitudinal fasciculus axonal fasciculation decreased occurrence, abnormal	zy8Tg + MO1-cntn2	Fig. 4 from Gurung et al., 2018
neuron migration disrupted, abnormal	rw0Tg + MO1-cntn2	Fig. 2 , Fig. 3 , Fig. 4 , Fig. 5 , Fig. 7 from Sittaramane et al., 2009
nucleus of the medial longitudinal fasciculus medulla oblongata neuron loose, abnormal	cntn2^zou20/zou20; zy8Tg + MO1-cntn2	Fig. 4 , Fig. 5 from Gurung et al., 2018
rhombomere 4 branchiomotor neuron mislocalised anteriorly, abnormal	rw0Tg + MO1-cntn2	Fig. 2 from Gurung et al., 2018
trigeminal ganglion disorganized, abnormal	rw0Tg + MO1-cntn2	Fig. 4 from Sittaramane et al., 2009
trigeminal ganglion dispersed, abnormal	rw0Tg + MO1-cntn2	Fig. 4 from Sittaramane et al., 2009

Phenotype of all Fish created by or utilizing MO1-cntn2

Phenotype	Fish	Conditions	Figures
facial nerve motor nucleus motor neuron mislocalised, abnormal	WT + MO1-cntn2	standard conditions	Fig. 4 from Sittaramane et al., 2009
neuron migration disrupted, abnormal	WT + MO1-cntn2	standard conditions	Fig. 4 from Sittaramane et al., 2009
facial nerve motor nucleus motor neuron mislocalised, abnormal	rw0Tg + MO1-cntn2	standard conditions	Fig. 2 , Fig. 3 , Fig. 5 , Fig. 7 from Sittaramane et al., 2009
branchiomotor neuron neuron migration decreased occurrence, abnormal	rw0Tg + MO1-cntn2	standard conditions	Fig. 2 , Fig. 5 from Gurung et al., 2018
rhombomere 4 branchiomotor neuron mislocalised anteriorly, abnormal	rw0Tg + MO1-cntn2	standard conditions	Fig. 2 from Gurung et al., 2018
trigeminal ganglion dispersed, abnormal	rw0Tg + MO1-cntn2	standard conditions	Fig. 4 from Sittaramane et al., 2009
trigeminal ganglion disorganized, abnormal	rw0Tg + MO1-cntn2	standard conditions	Fig. 4 from Sittaramane et al., 2009
neuron migration disrupted, abnormal	rw0Tg + MO1-cntn2	standard conditions	Fig. 2 , Fig. 3 , Fig. 5 , Fig. 7 from Sittaramane et al., 2009
medial longitudinal fasciculus axonal fasciculation decreased occurrence, abnormal	zy8Tg + MO1-cntn2	standard conditions	Fig. 4 from Gurung et al., 2018
axon guidance disrupted, abnormal	zy8Tg + MO1-cntn2	standard conditions	Fig. 3 , Fig. 4 , Fig. 5 from Wolman et al., 2008
axonogenesis neotenous growth, abnormal	zy8Tg + MO1-cntn2	standard conditions	Fig. 3 , Fig. 6 from Wolman et al., 2008
medial longitudinal fasciculus morphology, abnormal	zy8Tg + MO1-cntn2	standard conditions	Fig. 3 , Fig. 4 from Wolman et al., 2008
nucleus of the medial longitudinal fasciculus medulla oblongata neuron loose, abnormal	zy8Tg + MO1-cntn2	standard conditions	Fig. 4 , Fig. 5 from Gurung et al., 2018
branchiomotor neuron neuron migration decreased occurrence, abnormal	cntn2^zou20/zou20; rw0Tg + MO1-cntn2	standard conditions	Fig. 5 from Gurung et al., 2018
nucleus of the medial longitudinal fasciculus medulla oblongata neuron loose, abnormal	cntn2^zou20/zou20; zy8Tg + MO1-cntn2	standard conditions	Fig. 5 from Gurung et al., 2018
facial nerve motor nucleus motor neuron mislocalised, abnormal	lama1^uw1/+ + MO1-cntn2	standard conditions	Fig. 7 from Sittaramane et al., 2009
neuron migration disrupted, abnormal	lama1^uw1/+ + MO1-cntn2	standard conditions	Fig. 7 from Sittaramane et al., 2009
neuron migration disrupted, abnormal	rw0Tg + MO1-cntn2 + MO1-lama1	standard conditions	Fig. 7 from Sittaramane et al., 2009
facial nerve motor nucleus motor neuron mislocalised, abnormal	rw0Tg + MO1-cntn2 + MO1-lama1	standard conditions	Fig. 7 from Sittaramane et al., 2009
neuron migration disrupted, abnormal	rw0Tg + MO1-cntn2 + MO1-vangl2	standard conditions	Fig. 5 from Sittaramane et al., 2009
facial nerve motor nucleus motor neuron mislocalised, abnormal	rw0Tg + MO1-cntn2 + MO1-vangl2	standard conditions	Fig. 5 from Sittaramane et al., 2009
facial nerve motor nucleus motor neuron mislocalised, abnormal	vangl2^tc240/+; rw0Tg + MO1-cntn2	standard conditions	Fig. 5 from Sittaramane et al., 2009
neuron migration disrupted, abnormal	vangl2^tc240/+; rw0Tg + MO1-cntn2	standard conditions	Fig. 5 from Sittaramane et al., 2009

Citations