Morpholino
MO2-gata4
- ID
- ZDB-MRPHLNO-051128-2
- Name
- MO2-gata4
- Previous Names
- None
- Target
- Sequence
-
5' - TGGACGCAGACTGAGAGAAAGAGAG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
The sequence of the 2nd morpholino is correct, but was based on the ensemble record available at the time. However, the ensemble sequence has now been modified, and now the morpholino is not a perfect match. At the time it was to target intron 1- exon 2. But according to the update, it now targets intron 2-exon 3. Although it still is matched completely with the exon and most of the intron, it is now off for the last several bases of the intron.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-gata4
Expressed Gene | Anatomy | Figures |
---|---|---|
myh6 |
Fig. 3
from Holtzinger et al., 2007 |
|
myh7 |
Fig. 4
from Holtzinger et al., 2007 |
|
nkx2.5 |
Fig. 5
from Holtzinger et al., 2007 |
Phenotype
Phenotype resulting from MO2-gata4
No data available
Phenotype of all Fish created by or utilizing MO2-gata4
Citations