Morpholino

MO1-stat3

ID

ZDB-MRPHLNO-051004-1

Name

MO1-stat3

Previous Names

Target

Sequence

5' - GCCATGTTGACCCCTTAATGTGTCG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-stat3

Expressed Gene	Anatomy	Figures
stat3	Muller cell retina dorsal region retinal ganglion cell	Fig. 5 from Kassen et al., 2009
tbxta	notochord	Fig. 3 from Liu et al., 2017

Phenotype

Phenotype resulting from MO1-stat3

Phenotype	Fish	Figures
anterior macula has fewer parts of type hair cell anterior macula, abnormal	zf106Tg + MO1-stat3	Fig. 3 from Liang et al., 2012
Muller cell proliferative, abnormal	WT + MO1-stat3	Fig. 10 from Kassen et al., 2009
neuromast has fewer parts of type hair cell, abnormal	WT + MO1-stat3	Fig. 3 from Liang et al., 2012
notochord decreased length, abnormal	WT + MO1-stat3	Fig. 3 from Liu et al., 2017
notochord decreased length, exacerbated	stat3^stl27/stl27 + MO1-stat3	Fig. 3 from Liu et al., 2017
otic vesicle has fewer parts of type otolith, abnormal	WT + MO1-stat3	Fig. 3 from Liang et al., 2012
posterior lateral line neuromast decreased amount, abnormal	WT + MO1-stat3	Fig. 3 from Liang et al., 2012
primordial germ cell decreased amount, abnormal	WT + MO1-stat3	Fig. 4 from Fontana et al., 2023

Phenotype of all Fish created by or utilizing MO1-stat3

Phenotype	Fish	Conditions	Figures
notochord decreased length, exacerbated	stat3^stl27/stl27 + MO1-stat3	standard conditions	Fig. 3 from Liu et al., 2017
Muller cell proliferative, abnormal	WT + MO1-stat3	standard conditions	Fig. 10 from Kassen et al., 2009
posterior lateral line neuromast decreased amount, abnormal	WT + MO1-stat3	standard conditions	Fig. 3 from Liang et al., 2012
otic vesicle has fewer parts of type otolith, abnormal	WT + MO1-stat3	standard conditions	Fig. 3 from Liang et al., 2012
neuromast has fewer parts of type hair cell, abnormal	WT + MO1-stat3	standard conditions	Fig. 3 from Liang et al., 2012
primordial germ cell decreased amount, abnormal	WT + MO1-stat3	control	Fig. 4 from Fontana et al., 2023
notochord decreased length, abnormal	WT + MO1-stat3	standard conditions	Fig. 3 from Liu et al., 2017
anterior macula has fewer parts of type hair cell anterior macula, abnormal	zf106Tg + MO1-stat3	standard conditions	Fig. 3 from Liang et al., 2012
eye photoreceptor cell apoptotic, abnormal	slc45a2^unspecified + MO1-stat3	standard conditions	Fig. 6 from Kassen et al., 2009

Citations