Morpholino
MO1-fgf24
- ID
- ZDB-MRPHLNO-050818-6
- Name
- MO1-fgf24
- Previous Names
-
- fgf24-MOE3I3 (1)
- Target
- Sequence
-
5' - AGGAGACTCCCGTACCGTACTTGCC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-fgf24
Expressed Gene | Anatomy | Figures |
---|---|---|
cp |
Fig. 5
from Manfroid et al., 2007 |
|
efna5a |
Fig. 1
from Picker et al., 2009 |
|
epha4b |
Fig. 1
from Picker et al., 2009 |
|
etv4 |
Fig. 6
from Manfroid et al., 2007 |
|
fgf10a |
Fig. 5
from Manfroid et al., 2007 |
|
foxd1 |
Fig. 1
from Picker et al., 2009 |
|
foxg1a |
Fig. 1
from Picker et al., 2009 |
|
isl1a |
Fig. 5
from Manfroid et al., 2007 |
|
prss1 |
Fig. 5
from Manfroid et al., 2007 |
|
ptf1a |
|
Fig. 5 ,
Fig. 6
from Manfroid et al., 2007 |
Phenotype
Phenotype resulting from MO1-fgf24
Phenotype | Fish | Figures |
---|---|---|
fin bud aplastic, abnormal | AB + MO1-fgf24 |
Fig. 5
from Manfroid et al., 2007 |
Phenotype of all Fish created by or utilizing MO1-fgf24
Citations