Morpholino

MO3-fn1a

ID
ZDB-MRPHLNO-050712-4
Name
MO3-fn1a
Previous Names
  • fn MO2 (1)
  • MO3-fn1
Target
Sequence
5' - CACAGGTGCGATTGAACACGCTAAA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-fn1a
Expressed Gene Anatomy Figures
fn1a Fig. 3 with image from Chiu et al., 2012
Phenotype
Phenotype resulting from MO3-fn1a
Phenotype Fish Figures
digestive tract morphogenesis disrupted, abnormal s843Tg + MO3-fn1a Fig. 2 with image from Chiu et al., 2012
dorsal aorta increased size, abnormal s843Tg + MO3-fn1a Fig. 2 with image from Chiu et al., 2012
dorsal aorta sprouting angiogenesis process quality, abnormal s843Tg + MO3-fn1a Fig. 2 with image from Chiu et al., 2012
interrenal angiogenic sprout absent, abnormal s843Tg + MO3-fn1a Fig. 3 with image from Chiu et al., 2012
interrenal primordium morphology, abnormal s843Tg + MO3-fn1a Fig. 2 with image,  Fig. 3 with image from Chiu et al., 2012
interrenal primordium position, abnormal s843Tg + MO3-fn1a Fig. 2 with image,  Fig. 3 with image from Chiu et al., 2012
interrenal primordium left side unfused from interrenal primordium right side, abnormal s843Tg + MO3-fn1a Fig. 2 with image,  Fig. 3 with image from Chiu et al., 2012
interrenal vessel absent, abnormal s843Tg + MO3-fn1a Fig. 3 with image from Chiu et al., 2012
somite 1 morphology, abnormal s843Tg + MO3-fn1a Fig. 2 with image from Chiu et al., 2012
somite 2 morphology, abnormal s843Tg + MO3-fn1a Fig. 2 with image from Chiu et al., 2012
somite 3 morphology, abnormal s843Tg + MO3-fn1a Fig. 2 with image from Chiu et al., 2012
somite 4 morphology, abnormal s843Tg + MO3-fn1a Fig. 2 with image from Chiu et al., 2012
subintestinal vein morphology, abnormal s843Tg + MO3-fn1a Fig. 2 with image from Chiu et al., 2012
trunk interstitial matrix morphology, abnormal s843Tg + MO3-fn1a Fig. 2 with image,  Fig. 3 with image from Chiu et al., 2012
Phenotype of all Fish created by or utilizing MO3-fn1a
Phenotype Fish Conditions Figures
dorsal aorta increased size, abnormal s843Tg + MO3-fn1a standard conditions Fig. 2 with image from Chiu et al., 2012
somite 3 morphology, abnormal s843Tg + MO3-fn1a standard conditions Fig. 2 with image from Chiu et al., 2012
interrenal primordium position, abnormal s843Tg + MO3-fn1a standard conditions Fig. 2 with image,  Fig. 3 with image from Chiu et al., 2012
interrenal angiogenic sprout absent, abnormal s843Tg + MO3-fn1a standard conditions Fig. 3 with image from Chiu et al., 2012
interrenal primordium morphology, abnormal s843Tg + MO3-fn1a standard conditions Fig. 2 with image,  Fig. 3 with image from Chiu et al., 2012
somite 4 morphology, abnormal s843Tg + MO3-fn1a standard conditions Fig. 2 with image from Chiu et al., 2012
somite 1 morphology, abnormal s843Tg + MO3-fn1a standard conditions Fig. 2 with image from Chiu et al., 2012
subintestinal vein morphology, abnormal s843Tg + MO3-fn1a standard conditions Fig. 2 with image from Chiu et al., 2012
trunk interstitial matrix morphology, abnormal s843Tg + MO3-fn1a standard conditions Fig. 2 with image,  Fig. 3 with image from Chiu et al., 2012
interrenal vessel absent, abnormal s843Tg + MO3-fn1a standard conditions Fig. 3 with image from Chiu et al., 2012
dorsal aorta sprouting angiogenesis process quality, abnormal s843Tg + MO3-fn1a standard conditions Fig. 2 with image from Chiu et al., 2012
somite 2 morphology, abnormal s843Tg + MO3-fn1a standard conditions Fig. 2 with image from Chiu et al., 2012
interrenal primordium left side unfused from interrenal primordium right side, abnormal s843Tg + MO3-fn1a standard conditions Fig. 2 with image,  Fig. 3 with image from Chiu et al., 2012
digestive tract morphogenesis disrupted, abnormal s843Tg + MO3-fn1a standard conditions Fig. 2 with image from Chiu et al., 2012
interrenal primordium left side unfused from interrenal primordium right side, abnormal s843Tg + MO2-itga5 + MO3-fn1a + MO3-itga5 standard conditions Fig. 7 with image from Chiu et al., 2012
interrenal angiogenic sprout absent, abnormal s843Tg + MO2-itga5 + MO3-fn1a + MO3-itga5 standard conditions Fig. 7 with image from Chiu et al., 2012
interrenal primordium morphology, abnormal s843Tg + MO2-itga5 + MO3-fn1a + MO3-itga5 standard conditions Fig. 7 with image from Chiu et al., 2012
interrenal primordium position, abnormal s843Tg + MO2-itga5 + MO3-fn1a + MO3-itga5 standard conditions Fig. 7 with image from Chiu et al., 2012
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.