Morpholino

MO1-gdf6a

ID
ZDB-MRPHLNO-050708-1
Name
MO1-gdf6a
Previous Names
  • rdr gtMO (1)
  • rdrgtMO (1)
Target
Sequence
5' - GCAATACAAACCTTTTCCCTTGTCC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking morpholino, resulting in production of gdf6a mRNA containing its lone intron. This allows for normal maternal gdf6a function, as gdf6a is required for patterning the early embryo, but inhibits zygotic gdf6a function prior to eye development. As high levels of necrosis are observed in gdf6a morphants, gdf6a morpholinos were co-injected with a p53 translation blocking morpholino. -- French et al. 2007, ZDB-PUB-070726-17
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-gdf6a
Phenotype
Phenotype resulting from MO1-gdf6a
Phenotype of all Fish created by or utilizing MO1-gdf6a
Phenotype Fish Conditions Figures
eye decreased size, abnormal AB + MO1-gdf6a + MO4-tp53 standard conditions Fig. 3 from Asai-Coakwell et al., 2009
Fig. 4Fig. 5 from Asai-Coakwell et al., 2007
cranial nerve II hypoplastic, abnormal AB + MO1-gdf6a + MO4-tp53 standard conditions Fig. 4 from Asai-Coakwell et al., 2007
post-vent region kinked, abnormal AB + MO1-gdf6a + MO4-tp53 standard conditions Fig. 3 from Asai-Coakwell et al., 2009
lens vacuolated, abnormal AB + MO1-gdf6a + MO4-tp53 standard conditions Fig. 4 from Asai-Coakwell et al., 2007
lens protruding, abnormal AB + MO1-gdf6a + MO4-tp53 standard conditions Fig. 4Fig. 5 from Asai-Coakwell et al., 2007
retina disorganized, abnormal AB + MO1-gdf6a + MO4-tp53 standard conditions Fig. 4 from Asai-Coakwell et al., 2007
optic fissure closure incomplete, abnormal AB + MO1-gdf6a + MO4-tp53 standard conditions Fig. 3 from Asai-Coakwell et al., 2009
Fig. 4Fig. 5 from Asai-Coakwell et al., 2007
retina malformed, abnormal AB + MO1-gdf6a + MO4-tp53 standard conditions Fig. 5 from Asai-Coakwell et al., 2007
muscle pioneer increased amount, abnormal WT + MO1-gdf6a chemical treatment: SU5402 Fig. 7 with image from Nguyen-Chi et al., 2012
trunk vasculature broken, abnormal WT + MO1-gdf6a standard conditions Fig. 1 from Krispin et al., 2017
muscle pioneer increased amount, abnormal WT + MO1-gdf6a standard conditions Fig. 7 with image from Nguyen-Chi et al., 2012
retina morphology, abnormal WT + MO1-gdf6a + MO4-tp53 standard conditions Fig. 7 with image from French et al., 2007
muscle pioneer increased amount, abnormal WT + MO1-gdf6a + MO4-tp53 standard conditions Fig. 7 with image from Nguyen-Chi et al., 2012
eye morphology, abnormal ua1013Tg + MO1-gdf6a standard conditions Fig. 4 with image from Hocking et al., 2018
superior ocular sulcus morphology, abnormal ua1013Tg + MO1-gdf6a standard conditions Fig. 4 with image from Hocking et al., 2018
superior ocular sulcus closure incomplete, abnormal ua1013Tg + MO1-gdf6a standard conditions Fig. 4 with image from Hocking et al., 2018
Citations