Morpholino

MO1-efnb2a

ID

ZDB-MRPHLNO-050523-1

Name

MO1-efnb2a

Previous Names

None

Target

efnb2a (1)

Sequence

5' - CGGTCAAATTCCGTTTCGCGGGA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-efnb2a

Expressed Gene	Anatomy	Figures
egr2b	rhombomere 3 rhombomere 5	Fig. 1 from Cooke et al., 2005
sema3gb	rhombomere	Fig. 1 from Cooke et al., 2005

Phenotype

Phenotype resulting from MO1-efnb2a

Phenotype	Fish	Figures
blood vessel morphogenesis disrupted, abnormal	WT + MO1-efnb2a	Fig. 4 from Herbert et al., 2009
dorsal aorta aplastic, abnormal	WT + MO1-efnb2a	Fig. 4 from Herbert et al., 2009

Phenotype of all Fish created by or utilizing MO1-efnb2a

Phenotype	Fish	Conditions	Figures
dorsal aorta aplastic, abnormal	WT + MO1-efnb2a	standard conditions	Fig. 4 from Herbert et al., 2009
blood vessel morphogenesis disrupted, abnormal	WT + MO1-efnb2a	standard conditions	Fig. 4 from Herbert et al., 2009
optic vesicle morphogenesis disrupted, abnormal	WT + MO1-efnb1 + MO1-efnb2a	standard conditions	Fig. 2 from Cavodeassi et al., 2013
trigeminal motor nucleus fused with trigeminal motor nucleus, abnormal	WT + MO1-efnb2a + MO1-epha4a	standard conditions	Fig. 1 from Cooke et al., 2005
rhombomere 5 rhombomere boundary formation process quality, abnormal	WT + MO1-efnb2a + MO1-epha4a	standard conditions	Fig. 1 from Cooke et al., 2005
rhombomere 3 rhombomere boundary formation process quality, abnormal	WT + MO1-efnb2a + MO1-epha4a	standard conditions	Fig. 1 from Cooke et al., 2005
abducens motor nucleus fused with abducens motor nucleus, abnormal	WT + MO1-efnb2a + MO1-epha4a	standard conditions	Fig. 1 from Cooke et al., 2005
rhombomere boundary formation process quality, abnormal	WT + MO1-efnb2a + MO1-epha4a	standard conditions	Fig. 1 from Cooke et al., 2005
optic vesicle morphogenesis disrupted, abnormal	WT + MO1-efnb1 + MO1-efnb2a + MO1-epha4a	standard conditions	Fig. 2 from Cavodeassi et al., 2013
eye field cell fate commitment involved in camera-type eye formation disrupted, abnormal	b1200Tg + MO1-efnb1 + MO1-efnb2a + MO1-epha4a	standard conditions	Fig. 4 from Cavodeassi et al., 2013
immature eye cell migration disrupted, abnormal	b1200Tg + MO1-efnb1 + MO1-efnb2a + MO1-epha4a	standard conditions	Fig. 4 from Cavodeassi et al., 2013
optic vesicle morphogenesis disrupted, abnormal	b1200Tg + MO1-efnb1 + MO1-efnb2a + MO1-epha4a	standard conditions	Fig. 4 from Cavodeassi et al., 2013
telencephalon cell migration disrupted, abnormal	b1200Tg + MO1-efnb1 + MO1-efnb2a + MO1-epha4a	standard conditions	Fig. 4 from Cavodeassi et al., 2013
eye field cell fate commitment involved in camera-type eye formation disrupted, abnormal	zf460Tg + MO1-efnb1 + MO1-efnb2a + MO1-epha4a	standard conditions	Fig. 4 from Cavodeassi et al., 2013
optic vesicle morphogenesis disrupted, abnormal	zf460Tg + MO1-efnb1 + MO1-efnb2a + MO1-epha4a	standard conditions	Fig. 4 from Cavodeassi et al., 2013
immature eye cell migration disrupted, abnormal	zf460Tg + MO1-efnb1 + MO1-efnb2a + MO1-epha4a	standard conditions	Fig. 4 from Cavodeassi et al., 2013
telencephalon cell migration disrupted, abnormal	zf460Tg + MO1-efnb1 + MO1-efnb2a + MO1-epha4a	standard conditions	Fig. 4 from Cavodeassi et al., 2013

Citations