Morpholino

MO1-yes1

ID
ZDB-MRPHLNO-050128-3
Name
MO1-yes1
Previous Names
  • Yes-MO (1)
  • yes1 MO (1)
Target
Sequence
5' - CCTCTTTACTCTTGACACAGCCCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Morpholino targets start of yes1
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-yes1
Expressed Gene Anatomy Figures
dharma Fig. 13 with image from Tsai et al., 2005
gsc Fig. 13 with image from Tsai et al., 2005
mixl1 Fig. 13 with image from Tsai et al., 2005
sebox Fig. 13 with image from Tsai et al., 2005
yes1 Fig. 10 with image from Tsai et al., 2005
Phenotype
Phenotype resulting from MO1-yes1
Phenotype Fish Figures
epiboly arrested, abnormal WT + MO1-yes1 Fig. 2 with image from Sempou et al., 2016
Phenotype of all Fish created by or utilizing MO1-yes1
Phenotype Fish Conditions Figures
epiboly arrested, abnormal WT + MO1-yes1 standard conditions Fig. 2 with image from Sempou et al., 2016
eye fused with eye, abnormal WT + MO1-fyna,fynb + MO1-yes1 standard conditions Fig. 1,  Fig. 3 from Jopling et al., 2005
mediolateral intercalation decreased rate, abnormal WT + MO1-fyna,fynb + MO1-yes1 standard conditions Fig. 2 from Jopling et al., 2005
convergent extension involved in gastrulation disrupted, abnormal WT + MO1-fyna,fynb + MO1-yes1 standard conditions Fig. 1 from Jopling et al., 2005
convergent extension disrupted, abnormal WT + MO1-fyna,fynb + MO1-yes1 standard conditions Fig. 2 with image from Lemeer et al., 2007
whole organism ab2-ctnnb labeling decreased amount, abnormal WT + MO1-fyna,fynb + MO1-yes1 standard conditions Fig. 3 with image from Sempou et al., 2016
epiboly arrested, abnormal WT + MO1-fyna,fynb + MO1-yes1 standard conditions Fig. 2 with image from Sempou et al., 2016
DEL intracellular anatomical structure ab2-ctnnb labeling mislocalised, abnormal WT + MO1-fyna,fynb + MO1-yes1 standard conditions Fig. 3 with image from Sempou et al., 2016
whole organism left-right axis increased width, abnormal WT + MO1-fyna,fynb + MO1-yes1 standard conditions Fig. 1 from Jopling et al., 2005
forebrain structure, abnormal WT + MO1-fyna,fynb + MO1-yes1 standard conditions Fig. 3 from Jopling et al., 2005
DEL cytosol ab2-ctnnb labeling mislocalised, abnormal WT + MO1-fyna,fynb + MO1-yes1 standard conditions Fig. 3 with image from Sempou et al., 2016
dorsal convergence decreased rate, abnormal WT + MO1-fyna,fynb + MO1-yes1 standard conditions Fig. 2 from Jopling et al., 2005
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-fyna,fynb + MO1-yes1 standard conditions Fig. 1,  Fig. 3 from Jopling et al., 2005
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-fyna,fynb + MO1-wnt5b + MO1-yes1 standard conditions Fig. 5 from Jopling et al., 2005
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-fyna,fynb + MO1-wnt11f2 + MO1-yes1 standard conditions Fig. 3 from Jopling et al., 2005
forebrain structure, abnormal WT + MO1-fyna,fynb + MO1-wnt11f2 + MO1-yes1 standard conditions Fig. 3 from Jopling et al., 2005
eye fused with eye, abnormal WT + MO1-fyna,fynb + MO1-wnt11f2 + MO1-yes1 standard conditions Fig. 3 from Jopling et al., 2005
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.