miRNA Gene
mir196c
- ID
- ZDB-MIRNAG-050712-1
- Name
- microRNA 196c
- Symbol
- mir196c Nomenclature History
- Previous Names
- Type
- miRNA_gene
- Location
- Chr: 11 Mapping Details/Browsers
- Description
- Predicted to have translation repressor activity, mRNA regulatory element binding. Predicted to be involved in mRNA cleavage involved in gene silencing by miRNA and miRNA mediated inhibition of translation. Human ortholog(s) of this gene implicated in hepatocellular carcinoma. Is expressed in neural tube and tail bud. Orthologous to human MIR196A2 (microRNA 196a-2).
- Genome Resources
- Note
-
Predicted Stem-Loop Sequence:
5' - AGCUGAUGCGUGGUUUAGGUAGUUUGAUGUUGUUGGGGUUGACUUCCUGGCUCGACAACAAGAAACUGCCUUGAUUACGUCAGUU - 3' (1) - Comparative Information
-
- All Expression Data
- 1 figure from He et al., 2011
- Cross-Species Comparison
- High Throughput Data
- Thisse Expression Data
- No data available
Wild Type Expression Summary
- All Phenotype Data
- No data available
- Cross-Species Comparison
- Alliance
Phenotype Summary
Mutations
Human Disease
Domain, Family, and Site Summary
No data available
Domain Details Per Protein
No data available
- Genome Browsers
| Type | Name | Annotation Method | Has Havana Data | Length (nt) | Analysis |
|---|---|---|---|---|---|
| miRNA | mir196a.2b-001 | 22 nt |
Interactions and Pathways
No data available
Plasmids
No data available