|
Fig. S5 Single numb and numblike knockdown reproduce the nb/nbl morphants hematopoietic defects with low penetrance. A–B. Injection of nb MO1 and nbl MO1 specifically blocks splicing of the targeted pre-mRNAs. PCR reactions were performed on cDNAs retrotranscribed from total RNA extracted from 29 hpf nb MO1 injected embryos (1.4 pmol/embryo; A), nbl MO1 injected embryos (0.3 pmol/embryo; B), std MO injected embryos (0.3 pmol/embryo or 1.4 pmol/embryo; A, B). β-actin has been tested as an internal control (data not shown). A control PCR reaction performed without cDNA is shown in lane 3 of both the boxes (A, B). Primers: nb MO1-5′: CACCAGTGGCAGACCGATGAA nb MO1-3′: ACCGCTCGCACAGCCTTCTTA nbl MO1-5′: TCGGGCTGGTGGAGGTGGAT nbl MO1-3′: CCGTCACGGCAGATGTAAGAG. C. Single injection of nb MO1 (1.4 pmol/embryo) or nbl MO1 (0.3 pmol/embryo) in Tg(gata1:dsRed) produces the hematopoietic phenotype respectively in ∼19% (n = 99) and ∼25% (n = 125) of the MO injected embryos (*p<0.05 vs std MO no defects, **p<0.01 vs std MO no defects, #p<0.05 vs std MO defects, ##p<0.01 vs std MO defects). 100% of control embryos was unaffected (n = 65).