CRISPR

CRISPR1-slc39a11

ID
ZDB-CRISPR-250206-3
Name
CRISPR1-slc39a11
Previous Names
None
Target
Sequence
5' - GGAGAAGATGAAGACCAGTG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
zju41 slc39a11
Expression
Gene expression in Wild Types + CRISPR1-slc39a11
No data available
Phenotype
Phenotype resulting from CRISPR1-slc39a11
No data available
Phenotype of all Fish created by or utilizing CRISPR1-slc39a11
Phenotype Fish Conditions Figures
testis disorganized, abnormal slc39a11zju41/zju41 standard conditions Fig. 4 with image from Xia et al., 2024
fin morphology, abnormal slc39a11zju41/zju41 standard conditions Fig. 1 with image from Xia et al., 2024
male organism swimming decreased process quality, abnormal slc39a11zju41/zju41 standard conditions Fig. 2 with image from Xia et al., 2024
female organism skeletal muscle cell increased amount, abnormal slc39a11zju41/zju41 standard conditions Fig. 2 with image from Xia et al., 2024
female organism skeletal muscle Ab2-HNE labeling increased distribution, abnormal slc39a11zju41/zju41 standard conditions Fig. 5 with image from Xia et al., 2024
male organism skeletal muscle Ab18-h2ax labeling increased distribution, abnormal slc39a11zju41/zju41 standard conditions Fig. 3 with image from Xia et al., 2024
male organism skeletal muscle cell decreased amount, abnormal slc39a11zju41/zju41 standard conditions Fig. 2 with image from Xia et al., 2024
female organism increased concentration female organism manganese(2+), abnormal slc39a11zju41/zju41 standard conditions Fig. 5 with image from Xia et al., 2024
female organism skeletal muscle myog expression increased amount, abnormal slc39a11zju41/zju41 cold damage: skeletal muscle Fig. 3 with image from Xia et al., 2024
epidermis refractivity, abnormal slc39a11zju41/zju41 standard conditions Fig. 1 with image from Xia et al., 2024
mid intestine intestinal villus increased ratio female organism mid intestine, abnormal slc39a11zju41/zju41 standard conditions Fig. 4 with image from Xia et al., 2024
posterior intestine intestinal villus decreased ratio posterior intestine, abnormal slc39a11zju41/zju41 standard conditions Fig. 4 with image from Xia et al., 2024
male organism increased concentration male organism iron cation, abnormal slc39a11zju41/zju41 standard conditions Fig. 5 with image from Xia et al., 2024
male organism skeletal muscle cell decreased area, abnormal slc39a11zju41/zju41 standard conditions Fig. 2 with image from Xia et al., 2024
intestinal bulb intestinal villus decreased ratio intestinal bulb, abnormal slc39a11zju41/zju41 standard conditions Fig. 4 with image from Xia et al., 2024
mid intestine intestinal villus decreased ratio male organism mid intestine, abnormal slc39a11zju41/zju41 standard conditions Fig. 4 with image from Xia et al., 2024
skeletal muscle skeletal muscle tissue regeneration decreased process quality, abnormal slc39a11zju41/zju41 cold damage: skeletal muscle Fig. 3 with image from Xia et al., 2024
skeletal muscle cell disorganized, abnormal slc39a11zju41/zju41 standard conditions Fig. 2 with image from Xia et al., 2024
male organism increased concentration male organism manganese(2+), abnormal slc39a11zju41/zju41 standard conditions Fig. 5 with image from Xia et al., 2024
female organism skeletal muscle sod2 expression increased amount, abnormal slc39a11zju41/zju41 standard conditions Fig. 5 with image from Xia et al., 2024
skeletal muscle cell decreased thickness, abnormal slc39a11zju41/zju41 standard conditions Fig. 2 with image from Xia et al., 2024
female organism skeletal muscle myod1 expression decreased amount, abnormal slc39a11zju41/zju41 cold damage: skeletal muscle Fig. 3 with image from Xia et al., 2024
male organism skeletal muscle Ab2-HNE labeling increased distribution, abnormal slc39a11zju41/zju41 standard conditions Fig. 5 with image from Xia et al., 2024
male organism skeletal muscle myod1 expression decreased amount, abnormal slc39a11zju41/zju41 cold damage: skeletal muscle Fig. 3 with image from Xia et al., 2024
male organism viability, abnormal slc39a11zju41/zju41 standard conditions Fig. 1 with image from Xia et al., 2024
oocyte stage I decreased ratio ovary, abnormal slc39a11zju41/zju41 standard conditions Fig. 4 with image from Xia et al., 2024
male organism DNA damage response increased process quality, abnormal slc39a11zju41/zju41 standard conditions Fig. 3 with image from Xia et al., 2024
male organism skeletal muscle myog expression decreased amount, abnormal slc39a11zju41/zju41 cold damage: skeletal muscle Fig. 3 with image from Xia et al., 2024
female organism viability, abnormal slc39a11zju41/zju41 standard conditions Fig. 1 with image from Xia et al., 2024
male organism skeletal muscle sod2 expression increased amount, abnormal slc39a11zju41/zju41 standard conditions Fig. 5 with image from Xia et al., 2024
Citations