CRISPR

CRISPR2-mapk7

ID

ZDB-CRISPR-240823-1

Name

CRISPR2-mapk7

Previous Names

exon 3 (1)

Target

mapk7 (1)

Sequence

5' - GGGGACTTCGGAATGGCACG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

The PAM site was "GGG" at the 3' end.

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
syu501	mapk7

Expression

Gene expression in Wild Types + CRISPR2-mapk7

No data available

Phenotype

Phenotype resulting from CRISPR2-mapk7

No data available

Phenotype of all Fish created by or utilizing CRISPR2-mapk7

Phenotype	Fish	Conditions	Figures
intestinal bulb fabp2 expression increased distribution, abnormal	mapk7^{syu501/syu501} (AB)	standard conditions	Fig. 3 from Lv et al., 2023
mid intestine fabp2 expression increased distribution, abnormal	mapk7^{syu501/syu501} (AB)	standard conditions	Fig. 3 from Lv et al., 2023
whole organism dead, abnormal	mapk7^{syu501/syu501} (AB)	standard conditions	Fig. 1 from Lv et al., 2023
intestinal epithelium zonula adherens immature, abnormal	mapk7^{syu501/syu501} (AB)	standard conditions	Fig. 6 from Lv et al., 2023
whole organism deformed, abnormal	mapk7^{syu501/syu501} (AB)	standard conditions	Fig. 1 from Lv et al., 2023
posterior intestine increased permeability, abnormal	mapk7^{syu501/syu501} (AB)	standard conditions	Fig. 3 from Lv et al., 2023
intestinal mucosa decreased thickness, abnormal	mapk7^{syu501/syu501} (AB)	standard conditions	Fig. 5 from Lv et al., 2023
whole organism timp2b expression increased amount, abnormal	mapk7^{syu501/syu501} (AB)	standard conditions	Fig. 9 from Lv et al., 2023
intestine decreased thickness, abnormal	mapk7^{syu501/syu501} (AB)	standard conditions	Fig. 4 from Lv et al., 2023
whole organism mmp9 expression increased amount, abnormal	mapk7^{syu501/syu501} (AB)	standard conditions	Fig. 9 from Lv et al., 2023
whole organism mmp13a.1 expression increased amount, abnormal	mapk7^{syu501/syu501} (AB)	standard conditions	Fig. 9 from Lv et al., 2023
intestine lumen morphology, abnormal	mapk7^{syu501/syu501} (AB)	standard conditions	Fig. 4, Fig. 5 from Lv et al., 2023
intestinal epithelium desmosome decreased distribution, abnormal	mapk7^{syu501/syu501} (AB)	standard conditions	Fig. 6 from Lv et al., 2023
intestinal epithelium tight junction immature, abnormal	mapk7^{syu501/syu501} (AB)	standard conditions	Fig. 6 from Lv et al., 2023
whole organism il1b expression increased amount, abnormal	mapk7^{syu501/syu501} (AB)	standard conditions	Fig. 9 from Lv et al., 2023
intestine increased permeability, abnormal	mapk7^{syu501/syu501} (AB)	standard conditions	Fig. 7 from Lv et al., 2023
intestine dysplastic, abnormal	mapk7^{syu501/syu501} (AB)	standard conditions	Fig. 5 from Lv et al., 2023
enteric musculature decreased thickness, abnormal	mapk7^{syu501/syu501} (AB)	standard conditions	Fig. 5 from Lv et al., 2023
whole organism lepb expression increased amount, abnormal	mapk7^{syu501/syu501} (AB)	standard conditions	Fig. 9 from Lv et al., 2023
intestine increased permeability, abnormal	mapk7^syu501/+ (AB)	chemical treatment by environment: dextran sulfate sodium	Fig. 8 from Lv et al., 2023

Citations