CRISPR

CRISPR1-znf469

ID
ZDB-CRISPR-240624-2
Name
CRISPR1-znf469
Previous Names
  • CRISPR1-si:ch211-220p4.1
Target
Sequence
5' - GAATACTTGGCACATGGAAG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site was "CGG" at the 3' end.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
zju237 znf469
Expression
Gene expression in Wild Types + CRISPR1-znf469
No data available
Phenotype
Phenotype resulting from CRISPR1-znf469
No data available
Phenotype of all Fish created by or utilizing CRISPR1-znf469
Phenotype Fish Conditions Figures
whole organism itgb1b.2 expression decreased amount, abnormal znf469zju237/zju237 standard conditions Fig. 7 from Bao et al., 2023
whole organism col2a1a expression decreased amount, abnormal znf469zju237/zju237 standard conditions Fig. 7 from Bao et al., 2023
corneal stroma decreased thickness, abnormal znf469zju237/zju237 standard conditions Fig. 5Fig. 6 from Bao et al., 2023
whole organism kera expression decreased amount, abnormal znf469zju237/zju237 standard conditions Fig. 7 from Bao et al., 2023
whole organism col1a1b expression decreased amount, abnormal znf469zju237/zju237 standard conditions Fig. 7 from Bao et al., 2023
whole organism psma1 expression increased amount, abnormal znf469zju237/zju237 standard conditions Fig. 7 from Bao et al., 2023
whole organism col5a1 expression decreased amount, abnormal znf469zju237/zju237 standard conditions Fig. 7 from Bao et al., 2023
whole organism psmc1a expression increased amount, abnormal znf469zju237/zju237 standard conditions Fig. 7 from Bao et al., 2023
trunk curved, abnormal znf469zju237/zju237 standard conditions Fig. 3 from Bao et al., 2023
swim bladder uninflated, abnormal znf469zju237/zju237 standard conditions Fig. 3 from Bao et al., 2023
whole organism col2a1b expression decreased amount, abnormal znf469zju237/zju237 standard conditions Fig. 7 from Bao et al., 2023
cornea central region decreased thickness, abnormal znf469zju237/zju237 standard conditions Fig. 5 from Bao et al., 2023
whole organism lum expression decreased amount, abnormal znf469zju237/zju237 standard conditions Fig. 7 from Bao et al., 2023
whole organism col1a1a expression decreased amount, abnormal znf469zju237/zju237 standard conditions Fig. 7 from Bao et al., 2023
whole organism psmd1 expression increased amount, abnormal znf469zju237/zju237 standard conditions Fig. 7 from Bao et al., 2023
whole organism dcn expression decreased amount, abnormal znf469zju237/zju237 standard conditions Fig. 7 from Bao et al., 2023
whole organism psmb1 expression increased amount, abnormal znf469zju237/zju237 standard conditions Fig. 7 from Bao et al., 2023
whole organism col1a2 expression decreased amount, abnormal znf469zju237/zju237 standard conditions Fig. 7 from Bao et al., 2023
cornea peripheral region decreased thickness, abnormal znf469zju237/zju237 standard conditions Fig. 6 from Bao et al., 2023
Citations