CRISPR

CRISPR1-dync1li1

ID

ZDB-CRISPR-240430-1

Name

CRISPR1-dync1li1

Previous Names

None

Target

dync1li1 (1)

Sequence

5' - GGATGGACAGAATTTATGGT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
he2	dync1li1

Expression

Gene expression in Wild Types + CRISPR1-dync1li1

No data available

Phenotype

Phenotype resulting from CRISPR1-dync1li1

No data available

Phenotype of all Fish created by or utilizing CRISPR1-dync1li1

Phenotype	Fish	Conditions	Figures
retinal outer plexiform layer Ab1-rab8a labeling increased distribution, abnormal	dync1li1^he2/he2 (AB)	standard conditions	Fig. 7 from Zhang et al., 2023
retina opn1lw1 expression increased amount, abnormal	dync1li1^he2/he2 (AB)	standard conditions	Fig. 4 from Zhang et al., 2023
retina opn1lw2 expression decreased amount, abnormal	dync1li1^he2/he2 (AB)	standard conditions	Fig. 4 from Zhang et al., 2023
short single cone cell disorganized, abnormal	dync1li1^he2/he2 (AB)	standard conditions	Fig. 5 from Zhang et al., 2023
retina opn1mw2 expression decreased amount, abnormal	dync1li1^he2/he2 (AB)	standard conditions	Fig. 4 from Zhang et al., 2023
long single cone cell cone photoreceptor outer segment sparse, abnormal	dync1li1^he2/he2 (AB)	standard conditions	Fig. 3 from Zhang et al., 2023
short double cone cell cone photoreceptor outer segment sparse, abnormal	dync1li1^he2/he2 (AB)	standard conditions	Fig. 3 from Zhang et al., 2023
long double cone cell degenerate, abnormal	dync1li1^he2/he2 (AB)	standard conditions	Fig. 5 from Zhang et al., 2023
retinal cone cell degenerate, abnormal	dync1li1^he2/he2 (AB)	standard conditions	Fig. 3 from Zhang et al., 2023
long single cone cell cone photoreceptor outer segment disorganized, abnormal	dync1li1^he2/he2 (AB)	standard conditions	Fig. 3 from Zhang et al., 2023
long double cone cell decreased amount, abnormal	dync1li1^he2/he2 (AB)	standard conditions	Fig. 5 from Zhang et al., 2023
retina opn1sw1 expression decreased amount, abnormal	dync1li1^he2/he2 (AB)	standard conditions	Fig. 4 from Zhang et al., 2023
long double cone cell cone photoreceptor outer segment sparse, abnormal	dync1li1^he2/he2 (AB)	standard conditions	Fig. 3 from Zhang et al., 2023
retinal cone cell cone photoreceptor outer segment decreased length, abnormal	dync1li1^he2/he2 (AB)	standard conditions	Fig. 2 from Zhang et al., 2023
retina opn1mw1 expression decreased amount, abnormal	dync1li1^he2/he2 (AB)	standard conditions	Fig. 4 from Zhang et al., 2023
retina opn1mw4 expression increased amount, abnormal	dync1li1^he2/he2 (AB)	standard conditions	Fig. 4 from Zhang et al., 2023
short double cone cell cone photoreceptor outer segment disorganized, abnormal	dync1li1^he2/he2 (AB)	standard conditions	Fig. 3 from Zhang et al., 2023
retinal photoreceptor layer apoptotic process increased process quality, abnormal	dync1li1^he2/he2 (AB)	standard conditions	Fig. 6 from Zhang et al., 2023
retinal cone cell nucleus disorganized, abnormal	dync1li1^he2/he2 (AB)	standard conditions	Fig. 2 from Zhang et al., 2023
long double cone cell cone photoreceptor outer segment disorganized, abnormal	dync1li1^he2/he2 (AB)	standard conditions	Fig. 3 from Zhang et al., 2023
long single cone cell degenerate, abnormal	dync1li1^he2/he2 (AB)	standard conditions	Fig. 5, Fig. 6 from Zhang et al., 2023
long single cone cell decreased amount, abnormal	dync1li1^he2/he2 (AB)	standard conditions	Fig. 5 from Zhang et al., 2023
retina opn1mw4 expression decreased amount, abnormal	dync1li1^he2/he2 (AB)	standard conditions	Fig. 4 from Zhang et al., 2023
retina opn1sw2 expression decreased amount, abnormal	dync1li1^he2/he2 (AB)	standard conditions	Fig. 4 from Zhang et al., 2023

Citations