CRISPR

CRISPR2-srebf1

ID

ZDB-CRISPR-240229-38

Name

CRISPR2-srebf1

Previous Names

None

Target

srebf1 (1)

Sequence

5' - GGCTCCGGCGGCTCCAGCAC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
zf3756	srebf1

Expression

Gene expression in Wild Types + CRISPR2-srebf1

No data available

Phenotype

Phenotype resulting from CRISPR2-srebf1

No data available

Phenotype of all Fish created by or utilizing CRISPR2-srebf1

Phenotype	Fish	Conditions	Figures
liver phosphatidylcholine 36:5 decreased amount, abnormal	srebf1^{zf3756/zf3756} (AB)	standard conditions	Fig. 2 from Sun et al., 2021
liver 1-acylglycerol 20:4 increased amount, abnormal	srebf1^{zf3756/zf3756} (AB)	standard conditions	Fig. 2 from Sun et al., 2021
hepatocyte lipid droplet decreased amount, abnormal	srebf1^{zf3756/zf3756} (AB)	low fat	Fig. 6 from Sun et al., 2021
whole organism decreased weight, abnormal	srebf1^{zf3756/zf3756} (AB)	low fat	Fig. 6 from Sun et al., 2021
whole organism adipose tissue decreased amount, abnormal	srebf1^{zf3756/zf3756} (AB)	standard conditions	Fig. 1 from Sun et al., 2021
liver phosphatidylcholine increased amount, abnormal	srebf1^{zf3756/zf3756} (AB)	standard conditions	Fig. 2 from Sun et al., 2021
liver acaca expression decreased amount, abnormal	srebf1^{zf3756/zf3756} (AB)	high fat	Fig. 6 from Sun et al., 2021
liver fatty acid decreased amount, abnormal	srebf1^{zf3756/zf3756} (AB)	standard conditions	Fig. 2 from Sun et al., 2021
liver lysophosphatidylcholine increased amount, abnormal	srebf1^{zf3756/zf3756} (AB)	standard conditions	Fig. 2 from Sun et al., 2021
liver scd expression decreased amount, abnormal	srebf1^{zf3756/zf3756} (AB)	standard conditions	Fig. 1 from Sun et al., 2021
liver acaca expression decreased amount, abnormal	srebf1^{zf3756/zf3756} (AB)	standard conditions	Fig. 1 from Sun et al., 2021
liver phosphatidylcholine 32:1 decreased amount, abnormal	srebf1^{zf3756/zf3756} (AB)	standard conditions	Fig. 2 from Sun et al., 2021
hepatocyte lipid droplet decreased amount, abnormal	srebf1^{zf3756/zf3756} (AB)	high fat	Fig. 6 from Sun et al., 2021
liver scd expression decreased amount, abnormal	srebf1^{zf3756/zf3756} (AB)	high fat	Fig. 6 from Sun et al., 2021
whole organism adipose tissue decreased amount, abnormal	srebf1^{zf3756/zf3756} (AB)	high fat	Fig. 6 from Sun et al., 2021
liver lipea expression increased amount, abnormal	srebf1^{zf3756/zf3756} (AB)	standard conditions	Fig. 1 from Sun et al., 2021
liver phosphatidylethanolamine 40:7 decreased amount, abnormal	srebf1^{zf3756/zf3756} (AB)	standard conditions	Fig. 2 from Sun et al., 2021
liver fas expression decreased amount, abnormal	srebf1^{zf3756/zf3756} (AB)	standard conditions	Fig. 1 from Sun et al., 2021
liver fas expression decreased amount, abnormal	srebf1^{zf3756/zf3756} (AB)	low fat	Fig. 6 from Sun et al., 2021
liver phosphatidylethanolamine 37:6 decreased amount, abnormal	srebf1^{zf3756/zf3756} (AB)	standard conditions	Fig. 2 from Sun et al., 2021
whole organism adipose tissue decreased amount, abnormal	srebf1^{zf3756/zf3756} (AB)	low fat	Fig. 6 from Sun et al., 2021
liver phosphatidylethanolamine 40:6 zwitterion decreased amount, abnormal	srebf1^{zf3756/zf3756} (AB)	standard conditions	Fig. 2 from Sun et al., 2021
liver acox1 expression increased amount, abnormal	srebf1^{zf3756/zf3756} (AB)	standard conditions	Fig. 1 from Sun et al., 2021
liver scd expression decreased amount, abnormal	srebf1^{zf3756/zf3756} (AB)	low fat	Fig. 6 from Sun et al., 2021
liver fas expression decreased amount, abnormal	srebf1^{zf3756/zf3756} (AB)	high fat	Fig. 6 from Sun et al., 2021
adipose tissue decreased distribution, abnormal	srebf1^{zf3756/zf3756} (AB)	standard conditions	Fig. 1 from Sun et al., 2021
liver lysophosphatidylethanolamine 22:6 decreased amount, abnormal	srebf1^{zf3756/zf3756} (AB)	standard conditions	Fig. 2 from Sun et al., 2021
liver lpla expression increased amount, abnormal	srebf1^{zf3756/zf3756} (AB)	standard conditions	Fig. 1 from Sun et al., 2021
liver phosphatidylcholine 37:5 decreased amount, abnormal	srebf1^{zf3756/zf3756} (AB)	standard conditions	Fig. 2 from Sun et al., 2021
whole organism decreased weight, abnormal	srebf1^{zf3756/zf3756} (AB)	high fat	Fig. 6 from Sun et al., 2021
liver acaca expression decreased amount, abnormal	srebf1^{zf3756/zf3756} (AB)	low fat	Fig. 6 from Sun et al., 2021
liver phospholipid increased amount, abnormal	srebf1^{zf3756/zf3756} (AB)	standard conditions	Fig. 2 from Sun et al., 2021
hepatocyte condensed, abnormal	srebf1^{zf3756/zf3756} (AB)	standard conditions	Fig. 1 from Sun et al., 2021

Citations