CRISPR

CRISPR3-nphs1

ID
ZDB-CRISPR-231208-2
Name
CRISPR3-nphs1
Previous Names
None
Target
Sequence
5' - GGGCCTCAGGGGCCGTGCAGT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site was "GGG" at the 3' end.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
mss102 nphs1
mss103 nphs1
Expression
Gene expression in Wild Types + CRISPR3-nphs1
No data available
Phenotype
Phenotype resulting from CRISPR3-nphs1
No data available
Phenotype of all Fish created by or utilizing CRISPR3-nphs1
Phenotype Fish Conditions Figures
mesonephric podocyte podocyte foot increased width, abnormal nphs1mss102/mss102 (AB) standard conditions FIGURE 3 with image from Lee et al., 2022
heart edematous, abnormal nphs1mss102/mss102 (AB) standard conditions FIGURE 1 with image from Lee et al., 2022
mesonephric podocyte mesonephric podocyte development decreased process quality, abnormal nphs1mss102/mss102 (AB) standard conditions FIGURE 3 with image from Lee et al., 2022
pronephric podocyte podocyte development decreased process quality, abnormal nphs1mss102/mss102 (AB) standard conditions FIGURE 3 with image from Lee et al., 2022
mesonephric podocyte lacks all parts of type mesonephric podocyte slit diaphragm, abnormal nphs1mss102/mss102 (AB) standard conditions FIGURE 3 with image from Lee et al., 2022
pronephric podocyte podocyte foot increased width, abnormal nphs1mss102/mss102 (AB) standard conditions FIGURE 3 with image from Lee et al., 2022
orbital region edematous, abnormal nphs1mss102/mss102 (AB) standard conditions FIGURE 1 with image from Lee et al., 2022
whole organism edematous, abnormal nphs1mss102/mss102 (AB) standard conditions FIGURE 1 with image from Lee et al., 2022
pronephric podocyte lacks all parts of type pronephric podocyte slit diaphragm, abnormal nphs1mss102/mss102 (AB) standard conditions FIGURE 3 with image from Lee et al., 2022
mesonephric podocyte podocyte foot increased width, abnormal nphs1mss103/mss103 (AB) standard conditions FIGURE 3 with image from Lee et al., 2022
mesonephric podocyte mesonephric podocyte development decreased process quality, abnormal nphs1mss103/mss103 (AB) standard conditions FIGURE 3 with image from Lee et al., 2022
heart edematous, abnormal nphs1mss103/mss103 (AB) standard conditions FIGURE 1 with image from Lee et al., 2022
pronephric podocyte podocyte development decreased process quality, abnormal nphs1mss103/mss103 (AB) standard conditions FIGURE 3 with image from Lee et al., 2022
mesonephric podocyte lacks all parts of type mesonephric podocyte slit diaphragm, abnormal nphs1mss103/mss103 (AB) standard conditions FIGURE 3 with image from Lee et al., 2022
orbital region edematous, abnormal nphs1mss103/mss103 (AB) standard conditions FIGURE 1 with image from Lee et al., 2022
pronephric podocyte podocyte foot increased width, abnormal nphs1mss103/mss103 (AB) standard conditions FIGURE 3 with image from Lee et al., 2022
whole organism edematous, abnormal nphs1mss103/mss103 (AB) standard conditions FIGURE 1 with image from Lee et al., 2022
pronephric podocyte lacks all parts of type pronephric podocyte slit diaphragm, abnormal nphs1mss103/mss103 (AB) standard conditions FIGURE 3 with image from Lee et al., 2022
pronephric podocyte Ab4-nphs2 labeling spatial pattern, abnormal nphs1mss102/mss102; zf238Tg standard conditions FIGURE 2 with image from Lee et al., 2022
pronephric podocyte nphs1 expression absent, abnormal nphs1mss102/mss102; zf238Tg standard conditions FIGURE 2 with image from Lee et al., 2022
pronephric podocyte Ab4-nphs2 labeling spatial pattern, abnormal nphs1mss103/mss103; zf238Tg standard conditions FIGURE 2 with image from Lee et al., 2022
pronephric podocyte nphs1 expression absent, abnormal nphs1mss103/mss103; zf238Tg standard conditions FIGURE 2 with image from Lee et al., 2022
renal protein absorption decreased process quality, abnormal nphs1mss102/mss102; mi1000Tg standard conditions FIGURE 4 with image from Lee et al., 2022
ocular blood vessel blood plasma EGFP expression decreased amount, abnormal nphs1mss102/mss102; mi1000Tg standard conditions FIGURE 4 with image from Lee et al., 2022
dorsal aorta blood plasma EGFP expression decreased amount, abnormal nphs1mss102/mss102; mi1000Tg standard conditions FIGURE 4 with image from Lee et al., 2022
renal protein absorption decreased process quality, abnormal nphs1mss103/mss103; mi1000Tg standard conditions FIGURE 4 with image from Lee et al., 2022
ocular blood vessel blood plasma EGFP expression decreased amount, abnormal nphs1mss103/mss103; mi1000Tg standard conditions FIGURE 4 with image from Lee et al., 2022
dorsal aorta blood plasma EGFP expression decreased amount, abnormal nphs1mss103/mss103; mi1000Tg standard conditions FIGURE 4 with image from Lee et al., 2022
Citations