CRISPR

CRISPR2-surf1

ID
ZDB-CRISPR-231108-14
Name
CRISPR2-surf1
Previous Names
None
Target
Sequence
5' - AGAAACCAGGACGAAAGGACAGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
cri1 surf1
Expression
Gene expression in Wild Types + CRISPR2-surf1
No data available
Phenotype
Phenotype resulting from CRISPR2-surf1
No data available
Phenotype of all Fish created by or utilizing CRISPR2-surf1
Phenotype Fish Conditions Figures
whole organism Ab4-cox4 labeling decreased amount, abnormal surf1cri1/cri1 standard conditions Fig. 2 from Haroon et al., 2023
swimming behavior decreased process quality, exacerbated surf1cri1/cri1 chemical treatment by environment: sodium azide Fig. 5 from Haroon et al., 2023
pupil decreased size, abnormal surf1cri1/cri1 standard conditions Fig. 4 from Haroon et al., 2023
heart contraction decreased process quality, exacerbated surf1cri1/cri1 chemical treatment by environment: sodium azide Fig. 5 from Haroon et al., 2023
swim bladder decreased size, abnormal surf1cri1/cri1 standard conditions Fig. 4 with imageFig. 5 with image from Sharma et al., 2023
swimming behavior decreased process quality, abnormal surf1cri1/cri1 standard conditions Fig. 3Fig. 5 from Haroon et al., 2023
liver decreased size, abnormal surf1cri1/cri1 standard conditions Fig. 4 with imageFig. 5 with image from Sharma et al., 2023
thigmotaxis decreased process quality, exacerbated surf1cri1/cri1 chemical treatment by environment: sodium azide Fig. 5 from Haroon et al., 2023
heart decreased size, abnormal surf1cri1/cri1 standard conditions Fig. 4 with imageFig. 5 with image from Sharma et al., 2023
iris elongated, abnormal surf1cri1/cri1 standard conditions Fig. 4 from Haroon et al., 2023
anterior chamber eye decreased size, abnormal surf1cri1/cri1 standard conditions Fig. 4 from Haroon et al., 2023
inner ear increased size, abnormal surf1cri1/cri1 standard conditions Fig. 4 with imageFig. 5 with image from Sharma et al., 2023
ciliary zone malformed, abnormal surf1cri1/cri1 standard conditions Fig. 4 from Haroon et al., 2023
vitreous increased size, abnormal surf1cri1/cri1 standard conditions Fig. 4 from Haroon et al., 2023
aqueous humor decreased size, abnormal surf1cri1/cri1 standard conditions Fig. 4 from Haroon et al., 2023
eye decreased size, abnormal surf1cri1/cri1 standard conditions Fig. 4 with imageFig. 5 with image from Sharma et al., 2023
regulation of cytochrome-c oxidase activity decreased process quality, abnormal surf1cri1/cri1 standard conditions Fig. 2 from Haroon et al., 2023
cranial nerve II decreased size, abnormal surf1cri1/cri1 standard conditions Fig. 4 with imageFig. 5 with image from Sharma et al., 2023
thigmotaxis decreased process quality, abnormal surf1cri1/cri1 standard conditions Fig. 5 from Haroon et al., 2023
heart contraction decreased process quality, abnormal surf1cri1/cri1 standard conditions Fig. 5 from Haroon et al., 2023
whole organism decreased weight, abnormal surf1cri1/cri1 standard conditions Fig. 6 with image from Sharma et al., 2023
brain decreased size, abnormal surf1cri1/cri1 standard conditions Fig. 4 with image from Sharma et al., 2023
corneal stroma increased thickness, abnormal surf1cri1/cri1 standard conditions Fig. 4 from Haroon et al., 2023
brain transparent, exacerbated surf1cri1/cri1 chemical treatment by environment: sodium azide Fig. 5 from Haroon et al., 2023
spinal cord decreased size, abnormal surf1cri1/cri1 standard conditions Fig. 4 with imageFig. 5 with image from Sharma et al., 2023
kidney decreased size, abnormal surf1cri1/cri1 standard conditions Fig. 4 with imageFig. 5 with image from Sharma et al., 2023
eye retinal inner nuclear layer decreased thickness, abnormal surf1cri1/cri1 standard conditions Fig. 4 from Haroon et al., 2023
brain transparent, abnormal surf1cri1/cri1 standard conditions Fig. 4Fig. 5 from Haroon et al., 2023
retina whorled, abnormal surf1cri1/cri1 standard conditions Fig. 4 from Haroon et al., 2023
brain increased size, abnormal surf1cri1/cri1 standard conditions Fig. 5 with image from Sharma et al., 2023
Citations