CRISPR

CRISPR4-hmox1a

ID
ZDB-CRISPR-231006-4
Name
CRISPR4-hmox1a
Previous Names
None
Target
Sequence
5' - GGTAAATGGGCTGCACTGCT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
No data available
Expression
Gene expression in Wild Types + CRISPR4-hmox1a
No data available
Phenotype
Phenotype resulting from CRISPR4-hmox1a
No data available
Phenotype of all Fish created by or utilizing CRISPR4-hmox1a
Phenotype Fish Conditions Figures
whole organism deformed, abnormal AB/TU + CRISPR1-hmox1a + CRISPR2-hmox1a + CRISPR3-hmox1a + CRISPR4-hmox1a control Fig. 4 from Luo et al., 2022
whole organism hmox2b expression decreased amount, abnormal AB/TU + CRISPR1-hmox1a + CRISPR2-hmox1a + CRISPR3-hmox1a + CRISPR4-hmox1a control Fig. 4 from Luo et al., 2022
whole organism hmox1b expression increased amount, abnormal AB/TU + CRISPR1-hmox1a + CRISPR2-hmox1a + CRISPR3-hmox1a + CRISPR4-hmox1a control Fig. 4 from Luo et al., 2022
whole organism hmox2a expression decreased amount, abnormal AB/TU + CRISPR1-hmox1a + CRISPR2-hmox1a + CRISPR3-hmox1a + CRISPR4-hmox1a control Fig. 4 from Luo et al., 2022
response to bacterium decreased process quality, abnormal WT + CRISPR1-hmox1a + CRISPR2-hmox1a + CRISPR3-hmox1a + CRISPR4-hmox1a bacterial treatment by injection: Mycobacterium marinum Fig. 1 from Luo et al., 2021
response to bacterium decreased process quality, abnormal WT + CRISPR1-hmox1a + CRISPR2-hmox1a + CRISPR3-hmox1a + CRISPR4-hmox1a bacterial treatment by injection: Mycobacterium marinum, chemical treatment by environment: hemin Fig. 4 from Luo et al., 2021
response to bacterium normal process quality, ameliorated WT + CRISPR1-hmox1a + CRISPR2-hmox1a + CRISPR3-hmox1a + CRISPR4-hmox1a bacterial treatment by injection: Mycobacterium marinum, chemical treatment by environment: ferrostatin-1 Fig. 5 from Luo et al., 2021
apoptotic process normal occurrence, ameliorated WT + CRISPR1-hmox1a + CRISPR2-hmox1a + CRISPR3-hmox1a + CRISPR4-hmox1a bacterial treatment by injection: Mycobacterium marinum, chemical treatment by environment: ferrostatin-1 Fig. 5 from Luo et al., 2021
apoptotic process increased occurrence, abnormal WT + CRISPR1-hmox1a + CRISPR2-hmox1a + CRISPR3-hmox1a + CRISPR4-hmox1a bacterial treatment by injection: Mycobacterium marinum Fig. 5 from Luo et al., 2021
intracellular iron ion homeostasis normal process quality, ameliorated WT + CRISPR1-hmox1a + CRISPR2-hmox1a + CRISPR3-hmox1a + CRISPR4-hmox1a bacterial treatment by injection: Mycobacterium marinum, chemical treatment by environment: ferrostatin-1 Fig. 5 from Luo et al., 2021
intracellular iron ion homeostasis decreased process quality, abnormal WT + CRISPR1-hmox1a + CRISPR2-hmox1a + CRISPR3-hmox1a + CRISPR4-hmox1a bacterial treatment by injection: Mycobacterium marinum Fig. 4,  Fig. 5 from Luo et al., 2021
trunk granulomatous inflammation Ab3-hmox1 labeling increased amount, abnormal WT + CRISPR1-hmox1a + CRISPR2-hmox1a + CRISPR3-hmox1a + CRISPR4-hmox1a bacterial treatment by injection: Mycobacterium marinum Fig. 1 from Luo et al., 2021
trunk granulomatous inflammation hmox1a expression increased amount, abnormal WT + CRISPR1-hmox1a + CRISPR2-hmox1a + CRISPR3-hmox1a + CRISPR4-hmox1a bacterial treatment by injection: Mycobacterium marinum Fig. 1 from Luo et al., 2021
whole organism hmox1a expression decreased amount, abnormal WT + CRISPR1-hmox1a + CRISPR2-hmox1a + CRISPR3-hmox1a + CRISPR4-hmox1a standard conditions Fig. 1 from Luo et al., 2021
post-vent region macrophage decreased distribution, abnormal vcc7Tg + CRISPR1-hmox1a + CRISPR2-hmox1a + CRISPR3-hmox1a + CRISPR4-hmox1a (AB) amputation: post-vent region Fig. 5 from Luo et al., 2022
whole organism deformed, abnormal AB/TU + CRISPR1-hmox1a + CRISPR1-hmox1b + CRISPR2-hmox1a + CRISPR2-hmox1b + CRISPR3-hmox1a + CRISPR3-hmox1b + CRISPR4-hmox1a + CRISPR4-hmox1b control Fig. 4 from Luo et al., 2022
whole organism viability, abnormal AB/TU + CRISPR1-hmox1a + CRISPR1-hmox1b + CRISPR2-hmox1a + CRISPR2-hmox1b + CRISPR3-hmox1a + CRISPR3-hmox1b + CRISPR4-hmox1a + CRISPR4-hmox1b control Fig. 4 from Luo et al., 2022
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.