CRISPR

CRISPR2-bag3

ID
ZDB-CRISPR-230629-2
Name
CRISPR2-bag3
Previous Names
None
Target
Sequence
5' - AATGTCCCCAGAGACTCCTC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
mnu10 bag3
Expression
Gene expression in Wild Types + CRISPR2-bag3
No data available
Phenotype
Phenotype resulting from CRISPR2-bag3
No data available
Phenotype of all Fish created by or utilizing CRISPR2-bag3
Phenotype Fish Conditions Figures
swimming decreased process quality, abnormal bag3mnu10/mnu10 (TL, TU) control Fig. 3Fig. 8 from Ruparelia et al., 2020
swimming decreased process quality, abnormal bag3mnu10/mnu10 (TL, TU) chemical treatment by environment: amiodarone Fig. 8 from Ruparelia et al., 2020
skeletal muscle cell skeletal muscle myofibril degenerate, abnormal bag3mnu10/mnu10 (TL, TU) mechanical stress, chemical treatment: methyl cellulose Fig. 2Fig. 8 from Ruparelia et al., 2020
skeletal muscle cell skeletal muscle myofibril structure, ameliorated bag3mnu10/mnu10 (TL, TU) mechanical stress, chemical treatment by environment: amiodarone, chemical treatment: methyl cellulose Fig. 8 from Ruparelia et al., 2020
autophagy decreased process quality, abnormal bag3mnu10/mnu10 (TL, TU) standard conditions Fig. 4 from Ruparelia et al., 2020
swimming process quality, ameliorated bag3mnu10/mnu10 (TL, TU) chemical treatment by environment: metformin Fig. 8 from Ruparelia et al., 2020
muscle cell cellular homeostasis disrupted, abnormal bag3mnu10/mnu10 (TL, TU) mechanical stress, chemical treatment: methyl cellulose Fig. 2Fig. 8 from Ruparelia et al., 2020
skeletal muscle cell skeletal muscle myofibril structure, ameliorated bag3mnu10/mnu10 (TL, TU) mechanical stress, chemical treatment by environment: metformin, chemical treatment: methyl cellulose Fig. 8 from Ruparelia et al., 2020
skeletal muscle cell skeletal muscle myofibril broken, abnormal bag3mnu10/mnu10 (TL, TU) mechanical stress, chemical treatment: methyl cellulose Fig. 2Fig. 8 from Ruparelia et al., 2020
skeletal muscle cell sarcolemma has extra parts of type skeletal muscle cell autophagosome, abnormal bag3mnu10/mnu10 (TL, TU) standard conditions Fig. 4 from Ruparelia et al., 2020
swimming decreased process quality, abnormal bag3mnu10/+ (TL, TU) standard conditions Fig. 3 from Ruparelia et al., 2020
skeletal muscle cell skeletal muscle myofibril degenerate, abnormal bag3mnu10/+ (TL, TU) mechanical stress, chemical treatment: methyl cellulose Fig. 2 from Ruparelia et al., 2020
skeletal muscle cell skeletal muscle myofibril broken, abnormal bag3mnu10/+ (TL, TU) mechanical stress, chemical treatment: methyl cellulose Fig. 2 from Ruparelia et al., 2020
muscle cell cellular homeostasis disrupted, abnormal bag3mnu10/+ (TL, TU) mechanical stress, chemical treatment: methyl cellulose Fig. 2 from Ruparelia et al., 2020
skeletal muscle cell sarcolemma has extra parts of type skeletal muscle cell autophagosome, abnormal bag3mnu10/+ (TL, TU) standard conditions Fig. 4 from Ruparelia et al., 2020
Citations