CRISPR

CRISPR1-aqp8a.2

ID
ZDB-CRISPR-230126-2
Name
CRISPR1-aqp8a.2
Previous Names
None
Target
Sequence
5' - GGTGACTCTGGTGGTCCTGA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
zf3698 aqp8a.2
zf3699 aqp8a.2
zf3700 aqp8a.2
Expression
Gene expression in Wild Types + CRISPR1-aqp8a.2
No data available
Phenotype
Phenotype resulting from CRISPR1-aqp8a.2
No data available
Phenotype of all Fish created by or utilizing CRISPR1-aqp8a.2
Phenotype Fish Conditions Figures
intestine fabp2 expression spatial pattern, abnormal aqp8a.2zf3698/zf3698 (AB) standard conditions Fig. 4 with imageFig. 5 with imageFig. 6 with image from Wang et al., 2022
pericardium edematous, abnormal aqp8a.2zf3698/zf3698 (AB) standard conditions Fig. 4 with image from Wang et al., 2022
whole organism decreased length, abnormal aqp8a.2zf3698/zf3698 (AB) standard conditions Fig. 4 with image from Wang et al., 2022
intestine deformed, abnormal aqp8a.2zf3698/zf3698 (AB) standard conditions Fig. 4 with imageFig. 5 with imageFig. 6 with image from Wang et al., 2022
intestine lumen absence of anatomical entity, abnormal aqp8a.2zf3698/zf3698 (AB) standard conditions Fig. 5 with image from Wang et al., 2022
intestine morphology, abnormal aqp8a.2zf3698/zf3698 (AB) standard conditions Fig. 4 with imageFig. 5 with imageFig. 6 with image from Wang et al., 2022
intestine bifurcated, abnormal aqp8a.2zf3698/zf3698 (AB) standard conditions Fig. 4 with imageFig. 5 with imageFig. 6 with image from Wang et al., 2022
pericardium edematous, abnormal aqp8a.2zf3699/zf3699 (AB) standard conditions Fig. 4 with image from Wang et al., 2022
whole organism decreased length, abnormal aqp8a.2zf3699/zf3699 (AB) standard conditions Fig. 4 with image from Wang et al., 2022
intestine deformed, abnormal aqp8a.2zf3699/zf3699 (AB) standard conditions Fig. 4 with imageFig. 5 with imageFig. 6 with image from Wang et al., 2022
intestine fabp2 expression spatial pattern, abnormal aqp8a.2zf3699/zf3699 (AB) standard conditions Fig. 4 with imageFig. 5 with imageFig. 6 with image from Wang et al., 2022
intestine lumen absence of anatomical entity, abnormal aqp8a.2zf3699/zf3699 (AB) standard conditions Fig. 5 with image from Wang et al., 2022
intestine bifurcated, abnormal aqp8a.2zf3699/zf3699 (AB) standard conditions Fig. 4 with imageFig. 5 with imageFig. 6 with image from Wang et al., 2022
intestine morphology, abnormal aqp8a.2zf3699/zf3699 (AB) standard conditions Fig. 4 with imageFig. 5 with imageFig. 6 with image from Wang et al., 2022
intestine bifurcated, abnormal aqp8a.2zf3700/zf3700 (AB) standard conditions Fig. 4 with imageFig. 5 with imageFig. 6 with image from Wang et al., 2022
intestine lumen absence of anatomical entity, abnormal aqp8a.2zf3700/zf3700 (AB) standard conditions Fig. 5 with image from Wang et al., 2022
whole organism decreased length, abnormal aqp8a.2zf3700/zf3700 (AB) standard conditions Fig. 4 with image from Wang et al., 2022
intestine morphology, abnormal aqp8a.2zf3700/zf3700 (AB) standard conditions Fig. 4 with imageFig. 5 with imageFig. 6 with image from Wang et al., 2022
intestine fabp2 expression spatial pattern, abnormal aqp8a.2zf3700/zf3700 (AB) standard conditions Fig. 4 with imageFig. 5 with imageFig. 6 with image from Wang et al., 2022
pericardium edematous, abnormal aqp8a.2zf3700/zf3700 (AB) standard conditions Fig. 4 with image from Wang et al., 2022
intestine deformed, abnormal aqp8a.2zf3700/zf3700 (AB) standard conditions Fig. 4 with imageFig. 5 with imageFig. 6 with image from Wang et al., 2022
Citations