CRISPR

CRISPR2-lmo2

ID
ZDB-CRISPR-230117-14
Name
CRISPR2-lmo2
Previous Names
None
Target
Sequence
5' - CGATGGCCTTCAGAAAGAAG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site was "CGG" at the 3' end.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
No data available
Expression
Gene expression in Wild Types + CRISPR2-lmo2
No data available
Phenotype
Phenotype resulting from CRISPR2-lmo2
No data available
Phenotype of all Fish created by or utilizing CRISPR2-lmo2
Phenotype Fish Conditions Figures
whole organism malformed, abnormal WIK + CRISPR2-lmo2 + CRISPR3-lmo2 + CRISPR4-lmo2 standard conditions FIGURE 3 with image from Winter et al., 2022
liver absent, abnormal WIK + CRISPR2-lmo2 + CRISPR3-lmo2 + CRISPR4-lmo2 standard conditions FIGURE 3 with image from Winter et al., 2022
heart malformed, abnormal WIK + CRISPR2-lmo2 + CRISPR3-lmo2 + CRISPR4-lmo2 standard conditions FIGURE 3 with image from Winter et al., 2022
swim bladder absent, abnormal WIK + CRISPR2-lmo2 + CRISPR3-lmo2 + CRISPR4-lmo2 standard conditions FIGURE 3 with image from Winter et al., 2022
atrium cardiac muscle contraction decreased frequency, abnormal WIK + CRISPR2-lmo2 + CRISPR3-lmo2 + CRISPR4-lmo2 standard conditions FIGURE 5 with image from Winter et al., 2022
somite malformed, abnormal WIK + CRISPR2-lmo2 + CRISPR3-lmo2 + CRISPR4-lmo2 standard conditions FIGURE 3 with image from Winter et al., 2022
cardiac ventricle malformed, abnormal WIK + CRISPR2-lmo2 + CRISPR3-lmo2 + CRISPR4-lmo2 standard conditions FIGURE 3 with image from Winter et al., 2022
pericardium edematous, abnormal WIK + CRISPR2-lmo2 + CRISPR3-lmo2 + CRISPR4-lmo2 standard conditions FIGURE 3 with image from Winter et al., 2022
cranial cartilage malformed, abnormal WIK + CRISPR2-lmo2 + CRISPR3-lmo2 + CRISPR4-lmo2 standard conditions FIGURE 3 with image from Winter et al., 2022
ball increased amount, abnormal WIK + CRISPR2-lmo2 + CRISPR3-lmo2 + CRISPR4-lmo2 standard conditions FIGURE 3 with image from Winter et al., 2022
cardiac ventricle cardiac muscle contraction decreased frequency, abnormal WIK + CRISPR2-lmo2 + CRISPR3-lmo2 + CRISPR4-lmo2 standard conditions FIGURE 5 with image from Winter et al., 2022
heart decreased size, abnormal WIK + CRISPR2-lmo2 + CRISPR3-lmo2 + CRISPR4-lmo2 standard conditions FIGURE 3 with image from Winter et al., 2022
neural tube malformed, abnormal WIK + CRISPR2-lmo2 + CRISPR3-lmo2 + CRISPR4-lmo2 standard conditions FIGURE 3 with image from Winter et al., 2022
atrium malformed, abnormal WIK + CRISPR2-lmo2 + CRISPR3-lmo2 + CRISPR4-lmo2 standard conditions FIGURE 3 with image from Winter et al., 2022
swim bladder uninflated, abnormal WIK + CRISPR2-lmo2 + CRISPR3-lmo2 + CRISPR4-lmo2 standard conditions FIGURE 3 with image from Winter et al., 2022
heart morphology, abnormal WIK + CRISPR2-lmo2 + CRISPR3-lmo2 + CRISPR4-lmo2 standard conditions FIGURE 3 with image from Winter et al., 2022
mandibular arch skeleton malformed, abnormal WIK + CRISPR2-lmo2 + CRISPR3-lmo2 + CRISPR4-lmo2 standard conditions FIGURE 3 with image from Winter et al., 2022
fin malformed, abnormal WIK + CRISPR2-lmo2 + CRISPR3-lmo2 + CRISPR4-lmo2 standard conditions FIGURE 3 with image from Winter et al., 2022
blood circulation absent process, abnormal WIK + CRISPR2-lmo2 + CRISPR3-lmo2 + CRISPR4-lmo2 standard conditions FIGURE 5 with image from Winter et al., 2022
liver increased size, abnormal WIK + CRISPR2-lmo2 + CRISPR3-lmo2 + CRISPR4-lmo2 standard conditions FIGURE 3 with image from Winter et al., 2022
notochord malformed, abnormal WIK + CRISPR2-lmo2 + CRISPR3-lmo2 + CRISPR4-lmo2 standard conditions FIGURE 3 with image from Winter et al., 2022
caudal fin malformed, abnormal WIK + CRISPR2-lmo2 + CRISPR3-lmo2 + CRISPR4-lmo2 standard conditions FIGURE 3 with image from Winter et al., 2022
Citations