CRISPR

CRISPR2-foxj1b

ID
ZDB-CRISPR-221221-7
Name
CRISPR2-foxj1b
Previous Names
None
Target
Sequence
5' - GGTCCACCCGCAATATTACG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
sq5719 foxj1b
Expression
Gene expression in Wild Types + CRISPR2-foxj1b
No data available
Phenotype
Phenotype resulting from CRISPR2-foxj1b
No data available
Phenotype of all Fish created by or utilizing CRISPR2-foxj1b
Phenotype Fish Conditions Figures
olfactory epithelium decreased size, abnormal foxj1bsq5719/sq5719 standard conditions Fig 2 with image from Rayamajhi et al., 2024
whole organism cnga4 expression decreased amount, abnormal foxj1bsq5719/sq5719 standard conditions Fig 3 with image from Rayamajhi et al., 2024
dorsal telencephalon lacks all parts of type ciliated cell, abnormal foxj1bsq5719/sq5719 standard conditions Fig. 5 with image from D'Gama et al., 2021
olfactory epithelium has fewer parts of type ciliated olfactory receptor neuron 9+2 non-motile cilium, abnormal foxj1bsq5719/sq5719 standard conditions Fig 2 with image from Rayamajhi et al., 2024
choroid plexus lacks parts or has fewer parts of type single ciliated epithelial cell, abnormal foxj1bsq5719/sq5719 standard conditions Fig. 5 with image from D'Gama et al., 2021
telencephalic ventricle increased size, abnormal foxj1bsq5719/sq5719 standard conditions Fig. 7 with image from D'Gama et al., 2021
ciliated olfactory receptor neuron non-motile cilium assembly decreased process quality, abnormal foxj1bsq5719/sq5719 standard conditions Fig 2 with image from Rayamajhi et al., 2024
olfactory pit has fewer parts of type multi-ciliated epithelial cell motile cilium, abnormal foxj1bsq5719/sq5719 standard conditions Fig 2 with image from Rayamajhi et al., 2024
olfactory pit decreased size, abnormal foxj1bsq5719/sq5719 standard conditions Fig 2 with image from Rayamajhi et al., 2024
whole organism ompb expression decreased amount, abnormal foxj1bsq5719/sq5719 standard conditions Fig 3 with image from Rayamajhi et al., 2024
multi-ciliated epithelial cell differentiation decreased process quality, abnormal foxj1bsq5719/sq5719 standard conditions Fig 2 with image from Rayamajhi et al., 2024
olfactory epithelium ciliated olfactory receptor neuron poorly differentiated, abnormal foxj1bsq5719/sq5719 standard conditions Fig 3 with image from Rayamajhi et al., 2024
multi-ciliated epithelial cell motile cilium assembly decreased process quality, abnormal foxj1bsq5719/sq5719 standard conditions Fig 2 with image from Rayamajhi et al., 2024
olfactory pit ab1-tuba labeling absent, abnormal foxj1asq5717/sq5717; foxj1bsq5719/sq5719 standard conditions Fig 2 with image from Rayamajhi et al., 2024
olfactory epithelium decreased size, abnormal foxj1asq5717/sq5717; foxj1bsq5719/sq5719 standard conditions Fig 2 with image from Rayamajhi et al., 2024
olfactory epithelium has fewer parts of type ciliated olfactory receptor neuron 9+2 non-motile cilium, abnormal foxj1asq5717/sq5717; foxj1bsq5719/sq5719 standard conditions Fig 2 with image from Rayamajhi et al., 2024
olfactory epithelium ompb expression decreased amount, abnormal foxj1asq5717/sq5717; foxj1bsq5719/sq5719 standard conditions Fig 3 with image from Rayamajhi et al., 2024
olfactory pit decreased size, abnormal foxj1asq5717/sq5717; foxj1bsq5719/sq5719 standard conditions Fig 2 with image from Rayamajhi et al., 2024
olfactory pit lacks all parts of type multi-ciliated epithelial cell motile cilium, abnormal foxj1asq5717/sq5717; foxj1bsq5719/sq5719 standard conditions Fig 2 with image from Rayamajhi et al., 2024
ciliated olfactory receptor neuron non-motile cilium assembly decreased process quality, abnormal foxj1asq5717/sq5717; foxj1bsq5719/sq5719 standard conditions Fig 2 with image from Rayamajhi et al., 2024
multi-ciliated epithelial cell differentiation decreased process quality, abnormal foxj1asq5717/sq5717; foxj1bsq5719/sq5719 standard conditions Fig 2 with image from Rayamajhi et al., 2024
brain motile cilium absence of anatomical entity, abnormal foxj1asq5717/sq5717; foxj1bsq5719/sq5719 standard conditions Fig. 5 with image from D'Gama et al., 2021
olfactory epithelium cnga4 expression decreased amount, abnormal foxj1asq5717/sq5717; foxj1bsq5719/sq5719 standard conditions Fig 3 with image from Rayamajhi et al., 2024
olfactory epithelium ciliated olfactory receptor neuron poorly differentiated, abnormal foxj1asq5717/sq5717; foxj1bsq5719/sq5719 standard conditions Fig 3 with image from Rayamajhi et al., 2024
multi-ciliated epithelial cell motile cilium assembly decreased process quality, abnormal foxj1asq5717/sq5717; foxj1bsq5719/sq5719 standard conditions Fig 2 with image from Rayamajhi et al., 2024
olfactory epithelium GCaMP expression decreased amount, abnormal foxj1asq5717/sq5717; foxj1bsq5719/sq5719; jf4Tg chemical treatment by environment: bile acid Fig 4 with image from Rayamajhi et al., 2024
sensory perception of smell decreased process quality, abnormal foxj1asq5717/sq5717; foxj1bsq5719/sq5719; jf4Tg control Fig 4 with image from Rayamajhi et al., 2024
sensory perception of smell decreased process quality, abnormal foxj1asq5717/sq5717; foxj1bsq5719/sq5719; jf4Tg chemical treatment by environment: bile acid Fig 4 with image from Rayamajhi et al., 2024
choroid plexus motile cilium decreased amount, abnormal gmncsq34/sq34; foxj1bsq5719/sq5719 standard conditions Fig. 5 with image from D'Gama et al., 2021
tela chorioidea motile cilium decreased amount, abnormal gmncsq34/sq34; foxj1bsq5719/sq5719 standard conditions Fig. 5 with image from D'Gama et al., 2021
vertebral column rotational curvature, abnormal foxj1asq5717/+; gmncsq34/+; foxj1bsq5719/sq5719 standard conditions Fig. 7 with image from D'Gama et al., 2021
vertebral column increased curvature, abnormal foxj1asq5717/+; gmncsq34/+; foxj1bsq5719/sq5719 standard conditions Fig. 7 with image from D'Gama et al., 2021
vertebral column rotational curvature, abnormal foxj1asq5717/+; gmncsq34/sq34; foxj1bsq5719/+ standard conditions Fig. 7 with image from D'Gama et al., 2021
vertebral column increased curvature, abnormal foxj1asq5717/+; gmncsq34/sq34; foxj1bsq5719/+ standard conditions Fig. 7 with image from D'Gama et al., 2021
vertebral column increased curvature, abnormal foxj1asq5717/+; gmncsq34/sq34; foxj1bsq5719/sq5719 standard conditions Fig. 7 with image from D'Gama et al., 2021
vertebral column rotational curvature, abnormal foxj1asq5717/+; gmncsq34/sq34; foxj1bsq5719/sq5719 standard conditions Fig. 7 with image from D'Gama et al., 2021
Citations