CRISPR

CRISPR1-blm

ID

ZDB-CRISPR-221205-1

Name

CRISPR1-blm

Previous Names

None

Target

blm (1)

Sequence

5' - GGATTAACTGTATTTGTCTT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
elu10	blm
kh53	blm

Expression

Gene expression in Wild Types + CRISPR1-blm

No data available

Phenotype

Phenotype resulting from CRISPR1-blm

No data available

Phenotype of all Fish created by or utilizing CRISPR1-blm

Phenotype	Fish	Conditions	Figures
whole organism viability, abnormal	blm^elu10/elu10 (AB)	standard conditions	Fig. 2 from Annus et al., 2022
whole organism decreased life span, abnormal	blm^elu10/elu10 (AB)	standard conditions	Fig. 2 from Annus et al., 2022
whole organism morphology, abnormal	blm^elu10/elu10 (AB)	chemical treatment by environment: diepoxybutane	Fig. 2 from Annus et al., 2022
sperm decreased amount, abnormal	blm^elu10/elu10 (AB)	standard conditions	Fig. 3 from Annus et al., 2022
spermatogenic cyst apoptotic process increased process quality, abnormal	blm^elu10/elu10 (AB)	standard conditions	Fig. 4 from Annus et al., 2022
male organism spermatogenesis decreased process quality, abnormal	blm^elu10/elu10 (AB)	standard conditions	Fig. 4 from Annus et al., 2022
female organism absent, abnormal	blm^elu10/elu10 (AB)	standard conditions	Fig. 3 from Annus et al., 2022
male organism decreased male fertility, abnormal	blm^elu10/elu10 (AB)	standard conditions	Fig. 3 from Annus et al., 2022
whole organism ab7-h2afx labeling increased distribution, abnormal	blm^elu10/elu10 (AB)	chemical treatment by environment: diepoxybutane	Fig. 2 from Annus et al., 2022
spermatogenic cyst Ab3-sycp3 labeling spatial pattern, abnormal	blm^elu10/elu10 (AB)	standard conditions	Fig. 4 from Annus et al., 2022
whole organism morphology, abnormal	blm^elu10/elu10 (AB)	gamma ray	Fig. 2 from Annus et al., 2022
spermatogenic cyst meiotic cell cycle decreased process quality, abnormal	blm^elu10/elu10 (AB)	standard conditions	Fig. 4 from Annus et al., 2022
spermatogenic cyst ab5-casp3 labeling increased distribution, abnormal	blm^elu10/elu10 (AB)	standard conditions	Fig. 4 from Annus et al., 2022
whole organism DNA double-strand break processing increased process quality, abnormal	blm^elu10/elu10 (AB)	chemical treatment by environment: diepoxybutane	Fig. 2 from Annus et al., 2022
sperm decreased amount, abnormal	blm^kh53/kh53	standard conditions	Fig. 3 from Shin et al., 2021
spermatogenesis disrupted, abnormal	blm^kh53/kh53	standard conditions	Fig. 3 from Shin et al., 2021
female organism absent, abnormal	blm^kh53/kh53	standard conditions	Fig. 3 from Shin et al., 2021
male organism male sterile, abnormal	blm^kh53/kh53	standard conditions	Fig. 3 from Shin et al., 2021
whole organism morphology, abnormal	blm^elu10/+ (AB)	chemical treatment by environment: diepoxybutane	Fig. 2 from Annus et al., 2022
whole organism ab7-h2afx labeling increased distribution, abnormal	blm^elu10/+ (AB)	chemical treatment by environment: diepoxybutane	Fig. 2 from Annus et al., 2022
whole organism morphology, abnormal	blm^elu10/+ (AB)	gamma ray	Fig. 2 from Annus et al., 2022
germ line cell decreased amount, abnormal	blm^elu10/elu10; zf45Tg (AB)	standard conditions	Fig. 3 from Annus et al., 2022
female organism absent, abnormal	tp53^zdf1/+; blm^elu10/elu10 (AB)	standard conditions	Fig. 3 from Annus et al., 2022
female organism absent, abnormal	tp53^zdf1/zdf1; blm^elu10/elu10 (AB)	standard conditions	Fig. 3 from Annus et al., 2022

Citations