CRISPR

CRISPR2-bbs1

ID
ZDB-CRISPR-221104-4
Name
CRISPR2-bbs1
Previous Names
None
Target
Sequence
5' - GGACGTCTGGTGTCAGGCCA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site was "AGG" at the 3' end.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
ka742 bbs1
Expression
Gene expression in Wild Types + CRISPR2-bbs1
No data available
Phenotype
Phenotype resulting from CRISPR2-bbs1
No data available
Phenotype of all Fish created by or utilizing CRISPR2-bbs1
Phenotype Fish Conditions Figures
photoreceptor outer segment layer bbs4 expression decreased amount, abnormal bbs1ka742/ka742 (AB) standard conditions Fig. 5 with image from Masek et al., 2022
axis kinked, abnormal bbs1ka742/ka742 (AB) standard conditions Fig. 1 with image from Masek et al., 2022
axis kinked, abnormal bbs1ka742/ka742 (AB) standard conditions Fig. 1 with image from Masek et al., 2022
axis kinked, abnormal bbs1ka742/ka742 (AB) standard conditions Fig. 1 with image from Masek et al., 2022
photoreceptor outer segment layer bbs5 expression absent, abnormal bbs1ka742/ka742 (AB) standard conditions Fig. 5 with image from Masek et al., 2022
photoreceptor outer segment layer bbs2 expression absent, abnormal bbs1ka742/ka742 (AB) standard conditions Fig. 5 with image from Masek et al., 2022
axis curved, abnormal bbs1ka742/ka742 (AB) standard conditions Fig. 1 with image from Masek et al., 2022
axis curved, abnormal bbs1ka742/ka742 (AB) standard conditions Fig. 1 with image from Masek et al., 2022
photoreceptor outer segment layer bbs9 expression decreased amount, abnormal bbs1ka742/ka742 (AB) standard conditions Fig. 5 with image from Masek et al., 2022
photoreceptor outer segment layer bbs1 expression absent, abnormal bbs1ka742/ka742 (AB) standard conditions Fig. 5 with image from Masek et al., 2022
photoreceptor outer segment layer morphology, abnormal bbs1ka742/ka742 (AB) standard conditions Fig. 5 with imageFig. 6 with image from Masek et al., 2022
photoreceptor outer segment layer shortened, abnormal bbs1ka742/ka742 (AB) standard conditions Fig. 3 with image from Masek et al., 2022
photoreceptor outer segment layer cholesterol increased amount, abnormal bbs1ka742/ka742 (AB) standard conditions Fig. 6 with image from Masek et al., 2022
photoreceptor outer segment layer photoreceptor disc membrane disorganized, abnormal bbs1ka742/ka742 (AB) standard conditions Fig. 3 with image from Masek et al., 2022
photoreceptor outer segment layer photoreceptor disc membrane disorganized, abnormal bbs1ka742/ka742 (AB) standard conditions Fig. 6 with image from Masek et al., 2022
eye bbs1 expression decreased amount, abnormal bbs1ka742/ka742 (AB) standard conditions Fig. 4 with image from Masek et al., 2022
axis curved, abnormal bbs1ka742/ka742 (AB) standard conditions Fig. 1 with image from Masek et al., 2022
photoreceptor outer segment layer phosphatidylinositol 38:5 increased amount, abnormal bbs1ka742/ka742 (AB) standard conditions Fig. 6 with image from Masek et al., 2022
photoreceptor outer segment layer cholesterol increased amount, abnormal bbs1ka742/ka742 (AB) standard conditions Fig. 6 with image from Masek et al., 2022
photoreceptor outer segment layer shape, abnormal bbs1ka742/ka742 (AB) standard conditions Fig. 3 with image from Masek et al., 2022
photoreceptor outer segment layer cholesterol increased amount, abnormal bbs1ka742/ka742 (AB) standard conditions Fig. 6 with image from Masek et al., 2022
retinal pigmented epithelium inclusion body increased amount, abnormal bbs1ka742/ka742 (AB) standard conditions Fig. 3 with image from Masek et al., 2022
photoreceptor outer segment layer bbs7 expression decreased amount, abnormal bbs1ka742/ka742 (AB) standard conditions Fig. 5 with image from Masek et al., 2022
photoreceptor outer segment layer phospholipid increased amount, abnormal bbs1ka742/ka742 (AB) standard conditions Fig. 6 with image from Masek et al., 2022
photoreceptor outer segment layer vesicle increased amount, abnormal bbs1ka742/ka742 (AB) standard conditions Fig. 6 with image from Masek et al., 2022
eye detection of light stimulus involved in visual perception decreased process quality, abnormal bbs1ka742/ka742 (AB) standard conditions Fig. 2 with image from Masek et al., 2022
eye detection of light stimulus involved in visual perception decreased process quality, abnormal bbs1ka742/ka742 (AB) standard conditions Fig. 2 with imageFig. 3 with image from Masek et al., 2022
Citations