CRISPR

CRISPR1-plaat1

ID
ZDB-CRISPR-220215-1
Name
CRISPR1-plaat1
Previous Names
None
Target
Sequence
5' - GAGGTGTCGTATGACCTGCT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site was "GGG" at the 3' end.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
jt11 plaat1
Expression
Gene expression in Wild Types + CRISPR1-plaat1
No data available
Phenotype
Phenotype resulting from CRISPR1-plaat1
No data available
Phenotype of all Fish created by or utilizing CRISPR1-plaat1
Phenotype Fish Conditions Figures
lens translucent, abnormal plaat1jt11/jt11 standard conditions Fig. 4 from Morishita et al., 2021
lens central region has extra parts of type lens fiber cell endoplasmic reticulum, abnormal plaat1jt11/jt11 standard conditions Fig. 1 from Morishita et al., 2021
lens refractivity, abnormal plaat1jt11/jt11 standard conditions Fig. 4 from Morishita et al., 2021
lens fiber cell endoplasmic reticulum disassembly decreased process quality, abnormal plaat1jt11/jt11 standard conditions Fig. 1 from Morishita et al., 2021
lens fiber cell organelle disassembly decreased process quality, abnormal plaat1jt11/jt11 standard conditions Fig. 1 from Morishita et al., 2021
lens central region has extra parts of type lens fiber cell mitochondrion, abnormal plaat1jt11/jt11 standard conditions Fig. 1 from Morishita et al., 2021
lens central region has extra parts of type lens fiber cell lysosome, abnormal plaat1jt11/jt11 standard conditions Fig. 1 from Morishita et al., 2021
lens development in camera-type eye decreased process quality, abnormal plaat1jt11/jt11 standard conditions Fig. 4 from Morishita et al., 2021
lens fiber cell differentiation decreased process quality, abnormal plaat1jt11/jt11 standard conditions Fig. 1 from Morishita et al., 2021
lens central region has extra parts of type lens fiber cell endoplasmic reticulum, abnormal plaat1jt11/jt11; jt13Tg standard conditions Fig. 1 from Morishita et al., 2021
lens fiber cell organelle disassembly decreased process quality, abnormal plaat1jt11/jt11; jt13Tg standard conditions Fig. 1 from Morishita et al., 2021
lens fiber cell endoplasmic reticulum disassembly decreased process quality, abnormal plaat1jt11/jt11; jt13Tg standard conditions Fig. 1 from Morishita et al., 2021
lens central region has extra parts of type lens fiber cell mitochondrion, abnormal plaat1jt11/jt11; jt13Tg standard conditions Fig. 1Fig. 3 from Morishita et al., 2021
lens fiber cell differentiation decreased process quality, abnormal plaat1jt11/jt11; jt13Tg standard conditions Fig. 1Fig. 3 from Morishita et al., 2021
lens central region has number of lens fiber cell mitochondrion, ameliorated plaat1jt11/jt11; jt13Tg; jt14Tg standard conditions Fig. 2 from Morishita et al., 2021
Citations