CRISPR

CRISPR2-parlb

ID
ZDB-CRISPR-220203-5
Name
CRISPR2-parlb
Previous Names
None
Target
Sequence
5' - GGAAAGCGCAGTTTTATGCA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
ot510 parlb
Expression
Gene expression in Wild Types + CRISPR2-parlb
No data available
Phenotype
Phenotype resulting from CRISPR2-parlb
No data available
Phenotype of all Fish created by or utilizing CRISPR2-parlb
Phenotype Fish Conditions Figures
telencephalon dopaminergic neuron th expression decreased amount, abnormal parlbot510/ot510 standard conditions Fig. 3 from Merhi et al., 2021
swimming decreased frequency, abnormal parlbot510/ot510 standard conditions Fig. 5 from Merhi et al., 2021
brain parlb expression decreased amount, abnormal parlbot510/ot510 standard conditions Fig. 2 from Merhi et al., 2021
olfactory bulb dopaminergic neuron decreased amount, abnormal parlbot510/ot510 standard conditions Fig. 3 from Merhi et al., 2021
whole organism pink1 expression increased amount, abnormal parlbot510/ot510 standard conditions Fig. 2 from Merhi et al., 2021
brain fis1 expression increased amount, abnormal parlbot510/ot510 standard conditions Fig. 2 from Merhi et al., 2021
whole organism parla expression increased amount, abnormal parlbot510/ot510 standard conditions Fig. 2 from Merhi et al., 2021
brain th expression decreased amount, abnormal parlbot510/ot510 standard conditions Fig. 2 from Merhi et al., 2021
whole organism parlb expression absent, abnormal parlbot510/ot510 standard conditions Fig. 1 from Merhi et al., 2021
olfactory bulb dopaminergic neuron th expression decreased amount, abnormal parlbot510/ot510 standard conditions Fig. 3 from Merhi et al., 2021
whole organism opa1 expression increased amount, abnormal parlbot510/ot510 standard conditions Fig. 2 from Merhi et al., 2021
whole organism th expression decreased amount, abnormal parlbot510/ot510 standard conditions Fig. 2 from Merhi et al., 2021
whole organism fis1 expression increased amount, abnormal parlbot510/ot510 standard conditions Fig. 2 from Merhi et al., 2021
telencephalon dopaminergic neuron decreased amount, abnormal parlbot510/ot510 standard conditions Fig. 3 from Merhi et al., 2021
response to odorant disrupted, abnormal parlbot510/ot510 standard conditions Fig. 4 from Merhi et al., 2021
whole organism parlb expression decreased amount, abnormal parlbot510/ot510 standard conditions Fig. 2 from Merhi et al., 2021
brain fis1 expression increased amount, abnormal parlbot510/+ standard conditions Fig. 2 from Merhi et al., 2021
olfactory bulb dopaminergic neuron th expression decreased amount, abnormal parlbot510/+ standard conditions Fig. 3 from Merhi et al., 2021
brain parlb expression decreased amount, abnormal parlbot510/+ standard conditions Fig. 2 from Merhi et al., 2021
olfactory bulb dopaminergic neuron decreased amount, abnormal parlbot510/+ standard conditions Fig. 3 from Merhi et al., 2021
whole organism parlb expression decreased amount, abnormal parlbot510/+ standard conditions Fig. 2 from Merhi et al., 2021
brain th expression decreased amount, abnormal parlbot510/+ standard conditions Fig. 2 from Merhi et al., 2021
Citations