CRISPR

CRISPR1-ik

ID

ZDB-CRISPR-211216-4

Name

CRISPR1-ik

Previous Names

None

Target

ik (1)

Sequence

5' - GGCTCCAGATGGCCATGAGG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
zf3518	ik

Expression

Gene expression in Wild Types + CRISPR1-ik

No data available

Phenotype

Phenotype resulting from CRISPR1-ik

No data available

Phenotype of all Fish created by or utilizing CRISPR1-ik

Phenotype	Fish	Conditions	Figures
cardiac muscle contraction decreased frequency, abnormal	ik^{zf3518/zf3518}	standard conditions	Fig. 1 from In Ka et al., 2021
whole organism myod1 expression decreased amount, abnormal	ik^{zf3518/zf3518}	standard conditions	Fig. 4 from In Ka et al., 2021
whole organism cdkn1a expression increased amount, abnormal	ik^{zf3518/zf3518}	standard conditions	Fig. 2 from In Ka et al., 2021
somite pax7a expression increased amount, abnormal	ik^{zf3518/zf3518}	standard conditions	Fig. 4 from In Ka et al., 2021
whole organism tnni3k expression decreased amount, abnormal	ik^{zf3518/zf3518}	standard conditions	Fig. 2 from In Ka et al., 2021
fast muscle cell disorganized, abnormal	ik^{zf3518/zf3518}	standard conditions	Fig. 4 from In Ka et al., 2021
myotome pax7a expression increased amount, abnormal	ik^{zf3518/zf3518}	standard conditions	Fig. 4 from In Ka et al., 2021
trunk curved, abnormal	ik^{zf3518/zf3518}	standard conditions	Fig. 1 from In Ka et al., 2021
trunk dorsal region myod1 expression decreased amount, abnormal	ik^{zf3518/zf3518}	standard conditions	Fig. 4 from In Ka et al., 2021
whole organism deformed, abnormal	ik^{zf3518/zf3518}	standard conditions	Fig. 1 from In Ka et al., 2021
whole organism ik expression decreased amount, abnormal	ik^{zf3518/zf3518}	standard conditions	Fig. 1 from In Ka et al., 2021
pericardium edematous, abnormal	ik^{zf3518/zf3518}	standard conditions	Fig. 1 from In Ka et al., 2021
fast muscle cell kinked, abnormal	ik^{zf3518/zf3518}	standard conditions	Fig. 4 from In Ka et al., 2021
whole organism tnnt2e expression decreased amount, abnormal	ik^{zf3518/zf3518}	standard conditions	Fig. 2 from In Ka et al., 2021
neural tube dorsal region pax7a expression increased amount, abnormal	ik^{zf3518/zf3518}	standard conditions	Fig. 4 from In Ka et al., 2021
skeletal muscle acetylcholine-gated channel complex decreased amount, abnormal	ik^{zf3518/zf3518}	standard conditions	Fig. 4 from In Ka et al., 2021
whole organism pax7a expression increased amount, abnormal	ik^{zf3518/zf3518}	standard conditions	Fig. 4 from In Ka et al., 2021
whole organism mybpc1 expression decreased amount, abnormal	ik^{zf3518/zf3518}	standard conditions	Fig. 2 from In Ka et al., 2021
swimming behavior absent process, abnormal	ik^{zf3518/zf3518}	standard conditions	Fig. 1 from In Ka et al., 2021
mRNA splicing, via spliceosome disrupted, abnormal	ik^{zf3518/zf3518}	standard conditions	Fig. 3 from In Ka et al., 2021
whole organism acta1a expression decreased amount, abnormal	ik^{zf3518/zf3518}	standard conditions	Fig. 2 from In Ka et al., 2021
whole organism dead, abnormal	ik^{zf3518/zf3518}	standard conditions	Fig. 1 from In Ka et al., 2021
trunk curved ventral, abnormal	ik^{zf3518/zf3518}	standard conditions	Fig. 1 from In Ka et al., 2021
whole organism smyd1a expression decreased amount, abnormal	ik^{zf3518/zf3518}	standard conditions	Fig. 2 from In Ka et al., 2021
whole organism mybpc2a expression decreased amount, abnormal	ik^{zf3518/zf3518}	standard conditions	Fig. 2 from In Ka et al., 2021

Citations