CRISPR

CRISPR2-csf1ra

ID
ZDB-CRISPR-211216-3
Name
CRISPR2-csf1ra
Previous Names
None
Target
Sequence
5' - GTACGGGTCAGAACGAAGCT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
nku3 csf1ra
Expression
Gene expression in Wild Types + CRISPR2-csf1ra
No data available
Phenotype
Phenotype resulting from CRISPR2-csf1ra
No data available
Phenotype of all Fish created by or utilizing CRISPR2-csf1ra
Phenotype Fish Conditions Figures
whole organism cpa5 expression increased amount, abnormal csf1ranku3/nku3 (TU) standard conditions Fig. 3 from Meng et al., 2021
fin color pattern, abnormal csf1ranku3/nku3 (TU) standard conditions Fig. 2 from Meng et al., 2021
whole organism cel.1 expression increased amount, abnormal csf1ranku3/nku3 (TU) standard conditions Fig. 3 from Meng et al., 2021
integument color pattern, abnormal csf1ranku3/nku3 (TU) standard conditions Fig. 2 from Meng et al., 2021
whole organism locomotory behavior increased process quality, abnormal csf1ranku3/nku3 (TU) standard conditions Fig. 4 from Meng et al., 2021
whole organism slc22a7a expression decreased amount, abnormal csf1ranku3/nku3 (TU) standard conditions Fig. 3 from Meng et al., 2021
whole organism scarb1 expression increased amount, abnormal csf1ranku3/nku3 (TU) standard conditions Fig. 3 from Meng et al., 2021
integument xanthophore absent, abnormal csf1ranku3/nku3 (TU) standard conditions Fig. 2 from Meng et al., 2021
whole organism abcg5 expression increased amount, abnormal csf1ranku3/nku3 (TU) standard conditions Fig. 3 from Meng et al., 2021
whole organism cpb1 expression increased amount, abnormal csf1ranku3/nku3 (TU) standard conditions Fig. 3 from Meng et al., 2021
whole organism cyp7a1 expression increased amount, abnormal csf1ranku3/nku3 (TU) standard conditions Fig. 3 from Meng et al., 2021
integument melanophore stripe spatial pattern, abnormal csf1ranku3/nku3 (TU) standard conditions Fig. 2 from Meng et al., 2021
whole organism fabp6 expression increased amount, abnormal csf1ranku3/nku3 (TU) standard conditions Fig. 3 from Meng et al., 2021
hepatocyte lipid droplet increased amount, abnormal csf1ranku3/nku3 (TU) standard conditions Fig. 3 from Meng et al., 2021
whole organism ctrl expression increased amount, abnormal csf1ranku3/nku3 (TU) standard conditions Fig. 3 from Meng et al., 2021
integument melanophore stripe structurally discontinuous, abnormal csf1ranku3/nku3 (TU) standard conditions Fig. 2 from Meng et al., 2021
integument xanthophore decreased amount, abnormal csf1ranku3/nku3 (TU) standard conditions Fig. 2 from Meng et al., 2021
whole organism Ab1-csf1r labeling decreased amount, abnormal csf1ranku3/nku3 (TU) standard conditions Fig. 2 from Meng et al., 2021
whole organism fabp10a expression increased amount, abnormal csf1ranku3/nku3 (TU) standard conditions Fig. 3 from Meng et al., 2021
whole organism cpa4 expression increased amount, abnormal csf1ranku3/nku3 (TU) standard conditions Fig. 3 from Meng et al., 2021
whole organism plpp1a expression increased amount, abnormal csf1ranku3/nku3 (TU) standard conditions Fig. 3 from Meng et al., 2021
whole organism abcb11b expression increased amount, abnormal csf1ranku3/nku3 (TU) standard conditions Fig. 3 from Meng et al., 2021
whole organism cel.2 expression increased amount, abnormal csf1ranku3/nku3 (TU) standard conditions Fig. 3 from Meng et al., 2021
whole organism apoda.2 expression increased amount, abnormal csf1ranku3/nku3 (TU) standard conditions Fig. 3 from Meng et al., 2021
liver hepatocyte disorganized, abnormal csf1ranku3/nku3 (TU) standard conditions Fig. 3 from Meng et al., 2021
Citations