CRISPR

CRISPR1-bag3

ID
ZDB-CRISPR-210629-7
Name
CRISPR1-bag3
Previous Names
None
Target
Sequence
5' - GTCATGAAAACCCTGAACCCAGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
ulm104 bag3
Expression
Gene expression in Wild Types + CRISPR1-bag3
No data available
Phenotype
Phenotype resulting from CRISPR1-bag3
No data available
Phenotype of all Fish created by or utilizing CRISPR1-bag3
Phenotype Fish Conditions Figures
whole organism bag2 expression increased amount, abnormal bag3ulm104/ulm104 standard conditions Fig 5 with imageFig 8 with image from Diofano et al., 2020
whole organism bag3 expression decreased amount, abnormal bag3ulm104/ulm104 standard conditions Fig 1 with imageFig 8 with image from Diofano et al., 2020
whole organism bag3 expression absent, abnormal bag3ulm104/ulm104 standard conditions Fig 1 with image from Diofano et al., 2020
skeletal muscle structure, abnormal bag3ulm104/+ + MO2-bag3 standard conditions Fig 4 with image from Diofano et al., 2020
heart contraction decreased magnitude, abnormal bag3ulm104/+ + MO2-bag3 standard conditions Fig 4 with image from Diofano et al., 2020
response to mechanical stimulus decreased magnitude, abnormal bag3ulm104/+ + MO2-bag3 standard conditions Fig 4 with image from Diofano et al., 2020
skeletal muscle malformed, abnormal bag3ulm104/+ + MO2-bag3 standard conditions Fig 4 with image from Diofano et al., 2020
heart contraction decreased frequency, abnormal bag3ulm104/+ + MO2-bag3 standard conditions Fig 4 with image from Diofano et al., 2020
heart contraction decreased magnitude, abnormal bag3ulm104/+ + MO1-bag2 standard conditions Fig 7 with image from Diofano et al., 2020
heart contraction decreased magnitude, exacerbated bag3ulm104/ulm104 + MO1-bag2 standard conditions Fig 7 with image from Diofano et al., 2020
skeletal muscle structure, abnormal bag3ulm104/ulm104 + MO1-bag2 standard conditions Fig 7 with image from Diofano et al., 2020
response to mechanical stimulus decreased magnitude, abnormal bag3ulm104/ulm104 + MO1-bag2 standard conditions Fig 7 with image from Diofano et al., 2020
cardiac muscle structure, abnormal bag3ulm104/ulm104 + MO1-bag2 standard conditions Fig 7 with image from Diofano et al., 2020
heart contraction decreased magnitude, abnormal bag3ulm104/ulm104 + MO2-upf1 standard conditions Fig 8 with image from Diofano et al., 2020
cardiac muscle structure, abnormal bag3ulm104/ulm104 + MO2-upf1 standard conditions Fig 8 with image from Diofano et al., 2020
whole organism bag3 expression amount, ameliorated bag3ulm104/ulm104 + MO2-upf1 standard conditions Fig 8 with image from Diofano et al., 2020
whole organism bag2 expression amount, ameliorated bag3ulm104/ulm104 + MO2-upf1 standard conditions Fig 8 with image from Diofano et al., 2020
heart contraction decreased frequency, abnormal bag3ulm104/ulm104 + MO2-upf1 standard conditions Fig 8 with image from Diofano et al., 2020
skeletal muscle malformed, abnormal bag3ulm104/ulm104 + MO2-upf1 standard conditions Fig 8 with image from Diofano et al., 2020
Citations