CRISPR

CRISPR1-fam50a

ID
ZDB-CRISPR-210309-3
Name
CRISPR1-fam50a
Previous Names
None
Target
Sequence
5' - AGAAGAACTCAGGCAGGAGT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
ck125a fam50a
Expression
Gene expression in Wild Types + CRISPR1-fam50a
No data available
Phenotype
Phenotype resulting from CRISPR1-fam50a
No data available
Phenotype of all Fish created by or utilizing CRISPR1-fam50a
Phenotype Fish Conditions Figures
head eftud2 expression increased amount, abnormal fam50ack125a/ck125a standard conditions Fig. 5 with image,  Fig. S18,  Table 2 from Lee et al., 2020
head fam50a expression decreased amount, abnormal fam50ack125a/ck125a standard conditions Table 2 from Lee et al., 2020
head prpf8 expression increased amount, abnormal fam50ack125a/ck125a standard conditions Fig. 5 with image,  Table 2 from Lee et al., 2020
head prpf3 expression increased amount, abnormal fam50ack125a/ck125a standard conditions Fig. 5 with image,  Table 2 from Lee et al., 2020
head prpf31 expression increased amount, abnormal fam50ack125a/ck125a standard conditions Fig. 5 with image,  Fig. S18,  Table 2 from Lee et al., 2020
head eif4a3 expression increased amount, abnormal fam50ack125a/ck125a standard conditions Fig. 5 with image,  Table 2 from Lee et al., 2020
head aaas expression decreased amount, abnormal fam50ack125a/ck125a standard conditions Fig. S16,  Table 2 from Lee et al., 2020
head deformed, abnormal fam50ack125a/ck125a standard conditions Fig. S18 from Lee et al., 2020
head snrnp200 expression increased amount, abnormal fam50ack125a/ck125a standard conditions Fig. 5 with image,  Table 2 from Lee et al., 2020
pericardium edematous, abnormal fam50ack125a/ck125a standard conditions Fig. S18 from Lee et al., 2020
head pcna expression decreased amount, abnormal fam50ack125a/ck125a standard conditions Table 2 from Lee et al., 2020
head ice1 expression increased amount, abnormal fam50ack125a/ck125a standard conditions Fig. 5 with image,  Table 2 from Lee et al., 2020
head prpf6 expression increased amount, abnormal fam50ack125a/ck125a standard conditions Fig. 5 with image,  Table 2 from Lee et al., 2020
head mdm2 expression increased amount, abnormal fam50ack125a/ck125a standard conditions Table 2 from Lee et al., 2020
head her4.1 expression decreased amount, abnormal fam50ack125a/ck125a standard conditions Table 2 from Lee et al., 2020
central nervous system her4.1 expression decreased amount, abnormal fam50ack125a/ck125a standard conditions Fig. S7 from Lee et al., 2020
head ccnd1 expression decreased amount, abnormal fam50ack125a/ck125a standard conditions Table 2 from Lee et al., 2020
head gss expression decreased amount, abnormal fam50ack125a/ck125a standard conditions Fig. S16,  Table 2 from Lee et al., 2020
head eda expression decreased amount, abnormal fam50ack125a/ck125a standard conditions Table 2 from Lee et al., 2020
brain her4.1 expression decreased amount, abnormal fam50ack125a/ck125a standard conditions Fig. S7 from Lee et al., 2020
head huwe1 expression decreased amount, abnormal fam50ack125a/ck125a standard conditions Table 2 from Lee et al., 2020
head snapc4 expression increased amount, abnormal fam50ack125a/ck125a standard conditions Fig. 5 with image,  Table 2 from Lee et al., 2020
head mettl16 expression increased amount, abnormal fam50ack125a/ck125a standard conditions Fig. S16,  Table 2 from Lee et al., 2020
midbrain pcna expression decreased amount, abnormal fam50ack125a/ck125a standard conditions Fig. S8 from Lee et al., 2020
head vwa7 expression decreased amount, abnormal fam50ack125a/ck125a standard conditions Fig. S16,  Table 2 from Lee et al., 2020
head tp53 expression increased amount, abnormal fam50ack125a/ck125a standard conditions Table 2 from Lee et al., 2020
head snrpe expression increased amount, abnormal fam50ack125a/ck125a standard conditions Fig. 5 with image,  Table 2 from Lee et al., 2020
head cdkn1a expression increased amount, abnormal fam50ack125a/ck125a standard conditions Table 2 from Lee et al., 2020
midbrain ccnd1 expression decreased amount, abnormal fam50ack125a/ck125a standard conditions Fig. S8 from Lee et al., 2020
head prpf4 expression increased amount, abnormal fam50ack125a/ck125a standard conditions Fig. 5 with image,  Table 2 from Lee et al., 2020
head sf3b4 expression increased amount, abnormal fam50ack125a/ck125a standard conditions Fig. 5 with image from Lee et al., 2020
ceratohyal cartilage increased angle to ceratohyal cartilage, abnormal fam50ack125a/ck125a; zf195Tg standard conditions Fig. 3 with image,  Fig. S10 from Lee et al., 2020
head prpf31 expression increased amount, abnormal tp53zdf1/zdf1; fam50ack125a/ck125a standard conditions Fig. S18 from Lee et al., 2020
head deformed, abnormal tp53zdf1/zdf1; fam50ack125a/ck125a standard conditions Fig. S18 from Lee et al., 2020
head eftud2 expression increased amount, abnormal tp53zdf1/zdf1; fam50ack125a/ck125a standard conditions Fig. S18 from Lee et al., 2020
pericardium edematous, abnormal tp53zdf1/zdf1; fam50ack125a/ck125a standard conditions Fig. S18 from Lee et al., 2020
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.