CRISPR

CRISPR2-mfap4

ID
ZDB-CRISPR-210309-2
Name
CRISPR2-mfap4
Previous Names
None
Targets
Sequence
5' - GGGAAAGATGAAGAGAACGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
imb5 mfap4.2
Expression
Gene expression in Wild Types + CRISPR2-mfap4
No data available
Phenotype
Phenotype resulting from CRISPR2-mfap4
No data available
Phenotype of all Fish created by or utilizing CRISPR2-mfap4
Phenotype Fish Conditions Figures
erythroid progenitor cell gata1a expression decreased amount, abnormal mfap4.2imb5/imb5 standard conditions Figure 5 with image from Ong et al., 2020
granulocyte monocyte progenitor cell spi1b expression decreased amount, abnormal mfap4.2imb5/imb5 standard conditions Figure 5 with image from Ong et al., 2020
common myeloid progenitor spi1b expression increased amount, abnormal mfap4.2imb5/imb5 standard conditions Figure 5 with image from Ong et al., 2020
macrophage lcp1 expression increased amount, abnormal mfap4.2imb5/imb5 standard conditions Figure 5 with image from Ong et al., 2020
hematopoietic multipotent progenitor cell gata2a expression decreased amount, abnormal mfap4.2imb5/imb5 standard conditions Figure 5 with image from Ong et al., 2020
hematopoietic multipotent progenitor cell runx1 expression decreased amount, abnormal mfap4.2imb5/imb5 standard conditions Figure 5 with image from Ong et al., 2020
macrophage mfap4.2 expression decreased amount, abnormal mfap4.2imb5/imb5 standard conditions Figure 2 with image from Ong et al., 2020
neutrophil mpx expression increased amount, abnormal mfap4.2imb5/imb5 standard conditions Figure 5 with image from Ong et al., 2020
granulocyte cpa5 expression decreased amount, abnormal mfap4.2imb5/imb5 standard conditions Figure 5 with image from Ong et al., 2020
whole organism mfap4.2 expression decreased amount, abnormal mfap4.2imb5/imb5 standard conditions Figure 2 with image from Ong et al., 2020
lymphoid progenitor cell ikzf1 expression decreased amount, abnormal mfap4.2imb5/imb5 standard conditions Figure 5 with image from Ong et al., 2020
macrophage EGFP expression decreased amount, abnormal mfap4.2imb5/imb5; gl22Tg/gl22Tg amputation: caudal fin Figure 3 with image from Ong et al., 2020
regenerating fin macrophage EGFP expression decreased amount, abnormal mfap4.2imb5/imb5; gl22Tg/gl22Tg amputation: caudal fin Figure 3 with image from Ong et al., 2020
macrophage EGFP expression decreased amount, abnormal mfap4.2imb5/imb5; gl22Tg/gl22Tg standard conditions Figure 3 with image from Ong et al., 2020
regenerating fin neutrophil migration increased rate of occurrence, abnormal mfap4.2imb5/imb5; gl22Tg/gl22Tg amputation: caudal fin Figure 4 with image from Ong et al., 2020
regenerating fin neutrophil EGFP expression increased amount, abnormal mfap4.2imb5/imb5; gl22Tg/gl22Tg amputation: caudal fin Figure 4 with image from Ong et al., 2020
caudal fin neutrophil EGFP expression increased amount, abnormal mfap4.2imb5/imb5; gl22Tg/gl22Tg standard conditions Figure 4 with image from Ong et al., 2020
Citations