CRISPR

CRISPR1-mapk8b

ID
ZDB-CRISPR-210106-2
Name
CRISPR1-mapk8b
Previous Names
None
Target
Sequence
5' - GGAGGCCGGTTGCAGCCGTT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
n3 mapk8b
Expression
Gene expression in Wild Types + CRISPR1-mapk8b
No data available
Phenotype
Phenotype resulting from CRISPR1-mapk8b
No data available
Phenotype of all Fish created by or utilizing CRISPR1-mapk8b
Phenotype Fish Conditions Figures
Kupffer's vesicle motile cilium decreased length, abnormal mapk8bn3/n3 standard conditions Fig. 1. with image from Derrick et al., 2022
notochord posterior region lft1 expression decreased distribution, abnormal mapk8bn3/n3 standard conditions Fig. 8. with image from Derrick et al., 2022
lateral plate mesoderm right side spaw expression mislocalised, abnormal mapk8bn3/n3 standard conditions Fig. 3. with image from Derrick et al., 2022
Kupffer's vesicle epithelial cilium movement involved in extracellular fluid movement decreased process quality, abnormal mapk8bn3/n3 standard conditions Fig. 2. with image from Derrick et al., 2022
Kupffer's vesicle Kupffer's vesicle development decreased process quality, abnormal mapk8bn3/n3 standard conditions Fig. 1. with imageFig. 2. with image from Derrick et al., 2022
Kupffer's vesicle cilium assembly decreased process quality, abnormal mapk8bn3/n3 standard conditions Fig. 1. with image from Derrick et al., 2022
Kupffer's vesicle motile cilium decreased length, abnormal mapk8an2/n2; mapk8bn3/n3 standard conditions Fig. 5. with image from Derrick et al., 2022
Kupffer's vesicle motile cilium decreased length, exacerbated mapk8an2/n2; mapk8bn3/n3 standard conditions Fig. 1. with image from Derrick et al., 2022
notochord posterior region lft1 expression decreased distribution, abnormal mapk8an2/n2; mapk8bn3/n3 standard conditions Fig. 8. with image from Derrick et al., 2022
Kupffer's vesicle epithelial cilium movement involved in extracellular fluid movement decreased process quality, exacerbated mapk8an2/n2; mapk8bn3/n3 standard conditions Fig. 2. with image from Derrick et al., 2022
lateral plate mesoderm right side spaw expression mislocalised, abnormal mapk8an2/n2; mapk8bn3/n3 standard conditions Fig. 3. with image from Derrick et al., 2022
Kupffer's vesicle Kupffer's vesicle development decreased process quality, abnormal mapk8an2/n2; mapk8bn3/n3 standard conditions Fig. 1. with imageFig. 2. with imageFig. 5. with image from Derrick et al., 2022
Kupffer's vesicle epithelial cilium movement involved in extracellular fluid movement decreased process quality, abnormal mapk8an2/n2; mapk8bn3/n3 standard conditions Fig. 5. with image from Derrick et al., 2022
Kupffer's vesicle cilium assembly decreased process quality, abnormal mapk8an2/n2; mapk8bn3/n3 standard conditions Fig. 1. with imageFig. 3. with imageFig. 5. with image from Derrick et al., 2022
anterior lateral plate mesoderm hand2 expression spatial pattern, abnormal mapk8an2/n2; mapk8bn3/n3 (AB) standard conditions Fig 7 with image from Santos-Ledo et al., 2020
cardiac ventricle cardiac muscle cell decreased amount, abnormal mapk8an2/n2; mapk8bn3/n3 (AB) standard conditions Fig 6 with image from Santos-Ledo et al., 2020
anterior lateral plate mesoderm hand2 expression decreased distribution, abnormal mapk8an2/n2; mapk8bn3/n3 (AB) standard conditions Fig 7 with image from Santos-Ledo et al., 2020
cardiac ventricle hypoplastic, abnormal mapk8an2/n2; mapk8bn3/n3 (AB) standard conditions Fig 6 with image from Santos-Ledo et al., 2020
cardiac muscle cell decreased amount, abnormal mapk8an2/n2; mapk8bn3/n3; twu34Tg (AB) standard conditions Fig 7 with image from Santos-Ledo et al., 2020
heart tube decreased length, abnormal mapk8an2/n2; mapk8bn3/n3; twu34Tg (AB) standard conditions Fig 5 with image from Santos-Ledo et al., 2020
cell migration involved in heart development decreased rate, abnormal mapk8an2/n2; mapk8bn3/n3; twu34Tg (AB) standard conditions Fig 7 with image from Santos-Ledo et al., 2020
cardiac ventricle decreased length, abnormal mapk8an2/n2; mapk8bn3/n3; twu34Tg (AB) standard conditions Fig 5 with image from Santos-Ledo et al., 2020
Kupffer's vesicle motile cilium decreased length, exacerbated mapk8an2/n2; mapk8bn3/n3; mapk9n4/n4 standard conditions Fig. 5. with image from Derrick et al., 2022
Kupffer's vesicle epithelial cilium movement involved in extracellular fluid movement decreased process quality, exacerbated mapk8an2/n2; mapk8bn3/n3; mapk9n4/n4 standard conditions Fig. 5. with image from Derrick et al., 2022
Kupffer's vesicle cilium assembly decreased process quality, abnormal mapk8an2/n2; mapk8bn3/n3; mapk9n4/n4 standard conditions Fig. 5. with image from Derrick et al., 2022
lateral plate mesoderm pitx2 expression decreased amount, abnormal mapk8an2/n2; mapk8bn3/n3; mapk9n4/n4 standard conditions Fig. 6. with image from Derrick et al., 2022
lateral plate mesoderm right side spaw expression mislocalised, abnormal mapk8an2/n2; mapk8bn3/n3; mapk9n4/n4 standard conditions Fig. 6. with image from Derrick et al., 2022
Kupffer's vesicle Kupffer's vesicle development decreased process quality, abnormal mapk8an2/n2; mapk8bn3/n3; mapk9n4/n4 standard conditions Fig. 5. with image from Derrick et al., 2022
notochord posterior region lft1 expression decreased distribution, abnormal mapk8an2/n2; mapk8bn3/n3; mapk9n4/n4 standard conditions Fig. 8. with image from Derrick et al., 2022
Citations