CRISPR

CRISPR1-mapk8a

ID

ZDB-CRISPR-210106-1

Name

CRISPR1-mapk8a

Previous Names

None

Target

mapk8a (1)

Sequence

5' - GGAATGGGATATCAAGCCAA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
n2	mapk8a

Expression

Gene expression in Wild Types + CRISPR1-mapk8a

No data available

Phenotype

Phenotype resulting from CRISPR1-mapk8a

No data available

Phenotype of all Fish created by or utilizing CRISPR1-mapk8a

Phenotype	Fish	Conditions	Figures
Kupffer's vesicle motile cilium decreased length, abnormal	mapk8a^n2/n2	standard conditions	Fig. 1. from Derrick et al., 2022
notochord posterior region lft1 expression decreased distribution, abnormal	mapk8a^n2/n2	standard conditions	Fig. 8. from Derrick et al., 2022
Kupffer's vesicle epithelial cilium movement involved in extracellular fluid movement decreased process quality, abnormal	mapk8a^n2/n2	standard conditions	Fig. 2. from Derrick et al., 2022
Kupffer's vesicle cilium assembly decreased process quality, abnormal	mapk8a^n2/n2	standard conditions	Fig. 1. from Derrick et al., 2022
Kupffer's vesicle Kupffer's vesicle development decreased process quality, abnormal	mapk8a^n2/n2	standard conditions	Fig. 1. , Fig. 2. from Derrick et al., 2022
presumptive cardiac ventricle heart tube decreased length, abnormal	mapk8a^n2/n2 (AB)	standard conditions	Fig 7 from Santos-Ledo et al., 2020
cardiac ventricle decreased functionality, abnormal	mapk8a^n2/n2 (AB)	standard conditions	Fig 5 from Santos-Ledo et al., 2020
cardiac ventricle cardiac muscle cell decreased amount, abnormal	mapk8a^n2/n2 (AB)	standard conditions	Fig 6 from Santos-Ledo et al., 2020
cardiac ventricle decreased contractility, abnormal	mapk8a^n2/n2 (AB)	standard conditions	Fig 5 from Santos-Ledo et al., 2020
heart contraction decreased rate, abnormal	mapk8a^n2/n2 (AB)	standard conditions	Fig 5 from Santos-Ledo et al., 2020
cardiac ventricle hypoplastic, abnormal	mapk8a^n2/n2 (AB)	standard conditions	Fig 6 from Santos-Ledo et al., 2020
heart tube decreased length, abnormal	mapk8a^n2/n2; twu34Tg (AB)	standard conditions	Fig 5 from Santos-Ledo et al., 2020
cardiac ventricle decreased length, abnormal	mapk8a^n2/n2; twu34Tg (AB)	standard conditions	Fig 5 from Santos-Ledo et al., 2020
Kupffer's vesicle motile cilium decreased length, abnormal	mapk8a^n2/n2; mapk8b^n3/n3	standard conditions	Fig. 5. from Derrick et al., 2022
Kupffer's vesicle motile cilium decreased length, exacerbated	mapk8a^n2/n2; mapk8b^n3/n3	standard conditions	Fig. 1. from Derrick et al., 2022
notochord posterior region lft1 expression decreased distribution, abnormal	mapk8a^n2/n2; mapk8b^n3/n3	standard conditions	Fig. 8. from Derrick et al., 2022
Kupffer's vesicle epithelial cilium movement involved in extracellular fluid movement decreased process quality, exacerbated	mapk8a^n2/n2; mapk8b^n3/n3	standard conditions	Fig. 2. from Derrick et al., 2022
lateral plate mesoderm right side spaw expression mislocalised, abnormal	mapk8a^n2/n2; mapk8b^n3/n3	standard conditions	Fig. 3. from Derrick et al., 2022
Kupffer's vesicle Kupffer's vesicle development decreased process quality, abnormal	mapk8a^n2/n2; mapk8b^n3/n3	standard conditions	Fig. 1. , Fig. 2. , Fig. 5. from Derrick et al., 2022
Kupffer's vesicle epithelial cilium movement involved in extracellular fluid movement decreased process quality, abnormal	mapk8a^n2/n2; mapk8b^n3/n3	standard conditions	Fig. 5. from Derrick et al., 2022
Kupffer's vesicle cilium assembly decreased process quality, abnormal	mapk8a^n2/n2; mapk8b^n3/n3	standard conditions	Fig. 1. , Fig. 3. , Fig. 5. from Derrick et al., 2022
anterior lateral plate mesoderm hand2 expression spatial pattern, abnormal	mapk8a^n2/n2; mapk8b^n3/n3 (AB)	standard conditions	Fig 7 from Santos-Ledo et al., 2020
cardiac ventricle cardiac muscle cell decreased amount, abnormal	mapk8a^n2/n2; mapk8b^n3/n3 (AB)	standard conditions	Fig 6 from Santos-Ledo et al., 2020
anterior lateral plate mesoderm hand2 expression decreased distribution, abnormal	mapk8a^n2/n2; mapk8b^n3/n3 (AB)	standard conditions	Fig 7 from Santos-Ledo et al., 2020
cardiac ventricle hypoplastic, abnormal	mapk8a^n2/n2; mapk8b^n3/n3 (AB)	standard conditions	Fig 6 from Santos-Ledo et al., 2020
cardiac muscle cell decreased amount, abnormal	mapk8a^n2/n2; mapk8b^n3/n3; twu34Tg (AB)	standard conditions	Fig 7 from Santos-Ledo et al., 2020
heart tube decreased length, abnormal	mapk8a^n2/n2; mapk8b^n3/n3; twu34Tg (AB)	standard conditions	Fig 5 from Santos-Ledo et al., 2020
cell migration involved in heart development decreased rate, abnormal	mapk8a^n2/n2; mapk8b^n3/n3; twu34Tg (AB)	standard conditions	Fig 7 from Santos-Ledo et al., 2020
cardiac ventricle decreased length, abnormal	mapk8a^n2/n2; mapk8b^n3/n3; twu34Tg (AB)	standard conditions	Fig 5 from Santos-Ledo et al., 2020
Kupffer's vesicle motile cilium decreased length, exacerbated	mapk8a^n2/n2; mapk8b^n3/n3; mapk9^n4/n4	standard conditions	Fig. 5. from Derrick et al., 2022
Kupffer's vesicle epithelial cilium movement involved in extracellular fluid movement decreased process quality, exacerbated	mapk8a^n2/n2; mapk8b^n3/n3; mapk9^n4/n4	standard conditions	Fig. 5. from Derrick et al., 2022
Kupffer's vesicle cilium assembly decreased process quality, abnormal	mapk8a^n2/n2; mapk8b^n3/n3; mapk9^n4/n4	standard conditions	Fig. 5. from Derrick et al., 2022
lateral plate mesoderm pitx2 expression decreased amount, abnormal	mapk8a^n2/n2; mapk8b^n3/n3; mapk9^n4/n4	standard conditions	Fig. 6. from Derrick et al., 2022
lateral plate mesoderm right side spaw expression mislocalised, abnormal	mapk8a^n2/n2; mapk8b^n3/n3; mapk9^n4/n4	standard conditions	Fig. 6. from Derrick et al., 2022
Kupffer's vesicle Kupffer's vesicle development decreased process quality, abnormal	mapk8a^n2/n2; mapk8b^n3/n3; mapk9^n4/n4	standard conditions	Fig. 5. from Derrick et al., 2022
notochord posterior region lft1 expression decreased distribution, abnormal	mapk8a^n2/n2; mapk8b^n3/n3; mapk9^n4/n4	standard conditions	Fig. 8. from Derrick et al., 2022

Citations