CRISPR

CRISPR1-stim2b

ID
ZDB-CRISPR-210105-10
Name
CRISPR1-stim2b
Previous Names
None
Target
Sequence
5' - GGACCAGCACATCACGGTGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site was "AGG" at the 3' end.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
waw301 stim2b
Expression
Gene expression in Wild Types + CRISPR1-stim2b
No data available
Phenotype
Phenotype resulting from CRISPR1-stim2b
No data available
Phenotype of all Fish created by or utilizing CRISPR1-stim2b
Phenotype Fish Conditions Figures
swimming increased linear velocity, abnormal stim2bwaw301/waw301 (AB) standard conditions Fig. 3Fig. 5 from Wasilewska et al., 2020
whole organism anxa3a expression increased amount, abnormal stim2bwaw301/waw301 (AB) standard conditions Fig. 2 from Wasilewska et al., 2020
response to light stimulus increased occurrence, exacerbated stim2bwaw301/waw301 (AB) chemical treatment by environment: L-glutamate(1-) Fig. 7 from Wasilewska et al., 2020
whole organism anxa1c expression increased amount, abnormal stim2bwaw301/waw301 (AB) standard conditions Fig. 2 from Wasilewska et al., 2020
whole organism gpr39 expression increased amount, abnormal stim2bwaw301/waw301 (AB) standard conditions Fig. 2 from Wasilewska et al., 2020
thigmotaxis increased rate of occurrence, abnormal stim2bwaw301/waw301 (AB) standard conditions Fig. 3 from Wasilewska et al., 2020
whole organism stim2b expression decreased amount, abnormal stim2bwaw301/waw301 (AB) standard conditions Fig. 1 from Wasilewska et al., 2020
response to light stimulus increased occurrence, abnormal stim2bwaw301/waw301 (AB) chemical treatment by environment: pentetrazol Fig. 6 from Wasilewska et al., 2020
whole organism orai1a expression decreased amount, abnormal stim2bwaw301/waw301 (AB) standard conditions Fig. 1 from Wasilewska et al., 2020
whole organism stim2a expression decreased amount, abnormal stim2bwaw301/waw301 (AB) standard conditions Fig. 1 from Wasilewska et al., 2020
swimming increased occurrence, abnormal stim2bwaw301/waw301 (AB) control Fig. 6Fig. 7 from Wasilewska et al., 2020
startle response increased occurrence, abnormal stim2bwaw301/waw301 (AB) chemical treatment by environment: pentetrazol Fig. 6 from Wasilewska et al., 2020
swimming occurrence, abnormal stim2bwaw301/waw301 (AB) standard conditions Fig. 4Fig. 5 from Wasilewska et al., 2020
whole organism anxa5a expression increased amount, abnormal stim2bwaw301/waw301 (AB) standard conditions Fig. 2 from Wasilewska et al., 2020
negative phototaxis increased occurrence, abnormal stim2bwaw301/waw301 (AB) standard conditions Fig. 4 from Wasilewska et al., 2020
whole organism ngdn expression decreased amount, abnormal stim2bwaw301/waw301 (AB) standard conditions Fig. 2 from Wasilewska et al., 2020
whole organism smc1a expression increased amount, abnormal stim2bwaw301/waw301 (AB) standard conditions Fig. 2 from Wasilewska et al., 2020
whole organism orai2 expression decreased amount, abnormal stim2bwaw301/waw301 (AB) standard conditions Fig. 1 from Wasilewska et al., 2020
whole organism rrm2 expression decreased amount, abnormal stim2bwaw301/waw301 (AB) standard conditions Fig. 2 from Wasilewska et al., 2020
swimming increased occurrence, exacerbated stim2bwaw301/waw301 (AB) chemical treatment by environment: pentetrazol Fig. 6 from Wasilewska et al., 2020
swimming increased linear velocity, abnormal stim2bwaw301/waw301 (AB) chemical treatment by environment: L-glutamate(1-) Fig. 7 from Wasilewska et al., 2020
phototaxis disrupted, abnormal stim2bwaw301/waw301 (AB) standard conditions Fig. 4 from Wasilewska et al., 2020
swimming increased occurrence, abnormal stim2bwaw301/waw301 (AB) chemical treatment by environment: pentetrazol Fig. 6 from Wasilewska et al., 2020
whole organism per1a expression decreased amount, abnormal stim2bwaw301/waw301 (AB) standard conditions Fig. 2 from Wasilewska et al., 2020
exploration behavior decreased occurrence, abnormal stim2bwaw301/waw301 (AB) standard conditions Fig. 3 from Wasilewska et al., 2020
swimming increased occurrence, exacerbated stim2bwaw301/waw301 (AB) chemical treatment by environment: L-glutamate(1-) Fig. 7 from Wasilewska et al., 2020
whole organism ecrg4b expression increased amount, abnormal stim2bwaw301/waw301 (AB) standard conditions Fig. 2 from Wasilewska et al., 2020
swimming increased linear velocity, abnormal stim2bwaw301/waw301 (AB) chemical treatment by environment: pentetrazol Fig. 6 from Wasilewska et al., 2020
whole organism homer2 expression decreased amount, abnormal stim2bwaw301/waw301 (AB) standard conditions Fig. 2 from Wasilewska et al., 2020
response to light stimulus increased occurrence, abnormal stim2bwaw301/waw301 (AB) control Fig. 7 from Wasilewska et al., 2020
periventricular grey zone calcium-mediated signaling amplitude, abnormal stim2bwaw301/waw301; a4598Tg (AB) standard conditions Fig. 2 from Wasilewska et al., 2020
periventricular grey zone calcium-mediated signaling process quality, abnormal stim2bwaw301/waw301; a4598Tg (AB) standard conditions Fig. 2 from Wasilewska et al., 2020
retinal inner plexiform layer decreased width, abnormal stim2awaw303/waw303; stim2bwaw301/waw301 (AB) standard conditions Fig. 6 with image from Baranykova et al., 2024
retinal photoreceptor layer eye photoreceptor cell area density, abnormal stim2awaw303/waw303; stim2bwaw301/waw301 (AB) standard conditions Fig. 5 with image from Baranykova et al., 2024
eye photoreceptor cell mitochondrial crista decreased area, abnormal stim2awaw303/waw303; stim2bwaw301/waw301 (AB) standard conditions Fig. 7 with image from Baranykova et al., 2024
retinal ganglion cell layer retinal ganglion cell decreased amount, abnormal stim2awaw303/waw303; stim2bwaw301/waw301 (AB) standard conditions Fig. 6 with image from Baranykova et al., 2024
whole organism decreased weight, abnormal stim2awaw303/waw303; stim2bwaw301/waw301 (AB) standard conditions Fig. 3 with image from Baranykova et al., 2024
retinal ganglion cell layer microglial cell increased amount, abnormal stim2awaw303/waw303; stim2bwaw301/waw301 (AB) standard conditions Fig. 6 with image from Baranykova et al., 2024
retinal photoreceptor layer eye photoreceptor cell decreased amount, abnormal stim2awaw303/waw303; stim2bwaw301/waw301 (AB) standard conditions Fig. 5 with image from Baranykova et al., 2024
retinal ganglion cell layer decreased width, abnormal stim2awaw303/waw303; stim2bwaw301/waw301 (AB) standard conditions Fig. 6 with image from Baranykova et al., 2024
retinal inner nuclear layer amacrine cell area density, abnormal stim2awaw303/waw303; stim2bwaw301/waw301 (AB) standard conditions Fig. 5 with image from Baranykova et al., 2024
retinal inner plexiform layer dendrite decreased amount, abnormal stim2awaw303/waw303; stim2bwaw301/waw301 (AB) standard conditions Fig. 6 with image from Baranykova et al., 2024
retinal inner nuclear layer amacrine cell decreased amount, abnormal stim2awaw303/waw303; stim2bwaw301/waw301 (AB) standard conditions Fig. 5 with image from Baranykova et al., 2024
Citations