CRISPR

CRISRP2-snord118a

ID
ZDB-CRISPR-201117-2
Name
CRISRP2-snord118a
Previous Names
None
Target
Sequence
5' - GGCGTCGTTTAAAAAGCATGTG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The first two "G"s were added to improve binding. The PAM site was "TGG" at the 3' end.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
ue501 snord118a
Expression
Gene expression in Wild Types + CRISRP2-snord118a
No data available
Phenotype
Phenotype resulting from CRISRP2-snord118a
No data available
Phenotype of all Fish created by or utilizing CRISRP2-snord118a
Phenotype Fish Conditions Figures
whole organism ccng1 expression increased amount, abnormal snord118aue501/ue501 standard conditions Fig. 6Fig. S12 from Badrock et al., 2020
whole organism baxa expression increased amount, abnormal snord118aue501/ue501 standard conditions Fig. 6Fig. S12 from Badrock et al., 2020
whole organism decreased life span, abnormal snord118aue501/ue501 standard conditions Fig. S4 from Badrock et al., 2020
whole organism cdkn1a expression increased amount, abnormal snord118aue501/ue501 standard conditions Fig. 6Fig. S12 from Badrock et al., 2020
whole organism dead, abnormal snord118aue501/ue501 standard conditions Fig. S4 from Badrock et al., 2020
whole organism mdm2 expression increased amount, abnormal snord118aue501/ue501 standard conditions Fig. 6Fig. S12 from Badrock et al., 2020
whole organism decreased length, abnormal snord118aue501/ue501; s843Tg standard conditions Fig. 2 from Badrock et al., 2020
yolk morphology, abnormal snord118aue501/ue501; s843Tg standard conditions Fig. S3 from Badrock et al., 2020
sprouting angiogenesis disrupted, abnormal snord118aue501/ue501; s843Tg standard conditions Fig. 2 from Badrock et al., 2020
extension morphology, abnormal snord118aue501/ue501; s843Tg standard conditions Fig. 2 from Badrock et al., 2020
melanocyte differentiation disrupted, abnormal snord118aue501/ue501; s843Tg standard conditions Fig. 2 from Badrock et al., 2020
trunk vasculature disorganized, abnormal snord118aue501/ue501; s843Tg standard conditions Fig. 2Fig. S3 from Badrock et al., 2020
heart edematous, abnormal snord118aue501/ue501; s843Tg standard conditions Fig. S3 from Badrock et al., 2020
angiogenic sprout decreased amount, abnormal snord118aue501/ue501; s843Tg standard conditions Fig. 2Fig. 6 from Badrock et al., 2020
midbrain hindbrain boundary morphology, abnormal snord118aue501/ue501; s843Tg standard conditions Fig. 2 from Badrock et al., 2020
whole organism mitochondrial small ribosomal subunit decreased amount, abnormal snord118aue501/ue501; s843Tg standard conditions Fig. 2 from Badrock et al., 2020
eye decreased size, abnormal snord118aue501/ue501; s843Tg standard conditions Fig. 2 from Badrock et al., 2020
hindbrain swollen, abnormal snord118aue501/ue501; s843Tg standard conditions Fig. 2Fig. S3 from Badrock et al., 2020
embryonic cranial skeleton morphogenesis disrupted, abnormal snord118aue501/ue501; s843Tg standard conditions Fig. S3 from Badrock et al., 2020
intestine immature, abnormal snord118aue501/ue501; s843Tg standard conditions Fig. S3 from Badrock et al., 2020
swim bladder uninflated, abnormal snord118aue501/ue501; s843Tg standard conditions Fig. S3 from Badrock et al., 2020
hindbrain Venus expression increased amount, abnormal snord118aue501/ue501; ue503Tg standard conditions Fig. 6Fig. S12 from Badrock et al., 2020
embryo development delayed, abnormal snord118aue501/ue501; ue503Tg standard conditions Fig. S12 from Badrock et al., 2020
fourth ventricle swollen, abnormal snord118aue501/ue501; ue503Tg standard conditions Fig. S12 from Badrock et al., 2020
somite Venus expression increased amount, abnormal snord118aue501/ue501; ue503Tg standard conditions Fig. 6Fig. S12 from Badrock et al., 2020
whole organism Venus expression increased amount, abnormal snord118aue501/ue501; ue503Tg standard conditions Fig. S12 from Badrock et al., 2020
eye decreased size, abnormal snord118aue501/ue501; ue503Tg standard conditions Fig. S12 from Badrock et al., 2020
eye Venus expression increased amount, abnormal snord118aue501/ue501; ue503Tg standard conditions Fig. 6Fig. S12 from Badrock et al., 2020
whole organism cdkn1a expression amount, ameliorated tp53zdf1/zdf1; snord118aue501/ue501 standard conditions Fig. 6 from Badrock et al., 2020
whole organism mdm2 expression amount, ameliorated tp53zdf1/zdf1; snord118aue501/ue501 standard conditions Fig. 6 from Badrock et al., 2020
whole organism baxa expression amount, ameliorated tp53zdf1/zdf1; snord118aue501/ue501 standard conditions Fig. 6 from Badrock et al., 2020
whole organism decreased length, abnormal tp53zdf1/zdf1; snord118aue501/ue501; s843Tg standard conditions Fig. S13 from Badrock et al., 2020
angiogenic sprout amount, ameliorated tp53zdf1/zdf1; snord118aue501/ue501; s843Tg standard conditions Fig. 6 from Badrock et al., 2020
extension morphology, abnormal tp53zdf1/zdf1; snord118aue501/ue501; s843Tg standard conditions Fig. S13 from Badrock et al., 2020
trunk vasculature morphology, ameliorated tp53zdf1/zdf1; snord118aue501/ue501; s843Tg standard conditions Fig. S13 from Badrock et al., 2020
whole organism mitochondrial small ribosomal subunit decreased amount, abnormal tp53zdf1/zdf1; snord118aue501/ue501; s843Tg standard conditions Fig. S13 from Badrock et al., 2020
hindbrain size, ameliorated tp53zdf1/zdf1; snord118aue501/ue501; s843Tg standard conditions Fig. S13 from Badrock et al., 2020
Citations