CRISPR

CRISPR1-smyhc1,smyhc2,smyhc3

ID

ZDB-CRISPR-201001-11

Previous Names

None

Targets

smyhc1 (1)
smyhc2 (1)
smyhc3 (1)

Sequence

5' - GGCTGACAGCATGTACTGGT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

The two "G"s at the beginning were likely added to improve binding.

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
mb16	smyhc1
mb16a	smyhc3
mb17	smyhc1
mb17a	smyhc3
mb18	smyhc1

Expression

Gene expression in Wild Types + CRISPR1-smyhc1,smyhc2,smyhc3

No data available

Phenotype

Phenotype resulting from CRISPR1-smyhc1,smyhc2,smyhc3

No data available

Phenotype of all Fish created by or utilizing CRISPR1-smyhc1,smyhc2,smyhc3

Phenotype	Fish	Conditions	Figures
muscle smyhc1 expression absent, abnormal	smyhc1^mb16/mb16	standard conditions	Fig. 1 from Li et al., 2020
whole organism smyhc2 expression increased amount, abnormal	smyhc1^mb17/mb17	standard conditions	Fig. 11 from Li et al., 2020
whole organism smyhc1 expression decreased amount, abnormal	smyhc1^mb17/mb17	standard conditions	Fig. 1, Fig. 11 from Li et al., 2020
muscle smyhc1 expression absent, abnormal	smyhc1^mb17/mb17	standard conditions	Fig. 1 from Li et al., 2020
slow muscle cell ab-f59 labeling absent, abnormal	smyhc1^mb17/mb17	standard conditions	Fig. 2, Fig. 11 from Li et al., 2020
slow muscle cell sarcomere decreased length, abnormal	smyhc1^mb17/mb17	standard conditions	Fig. 5, Fig. 13 from Li et al., 2020
whole organism myhz2 expression increased amount, abnormal	smyhc1^mb17/mb17	standard conditions	Fig. 1 from Li et al., 2020
slow muscle cell myosin filament absent, abnormal	smyhc1^mb17/mb17	standard conditions	Fig. 5 from Li et al., 2020
slow muscle cell organized, abnormal	smyhc1^mb17/mb17	standard conditions	Fig. 13 from Li et al., 2020
slow muscle cell disorganized, abnormal	smyhc1^mb17/mb17	standard conditions	Fig. 13 from Li et al., 2020
slow muscle cell M band absent, abnormal	smyhc1^mb17/mb17	standard conditions	Fig. 5 from Li et al., 2020
slow muscle cell Z disc disorganized, abnormal	smyhc1^mb17/mb17	standard conditions	Fig. 4 from Li et al., 2020
feeding behavior decreased occurrence, abnormal	smyhc1^mb17/mb17	standard conditions	Fig. 9 from Li et al., 2020
slow muscle cell sarcomere disorganized, abnormal	smyhc1^mb17/mb17	standard conditions	Fig. 6 from Li et al., 2020
swimming decreased linear velocity, abnormal	smyhc1^mb18/mb18	standard conditions	Fig. 8 from Li et al., 2020
whole organism smyhc1 expression decreased amount, abnormal	smyhc1^mb18/mb18	standard conditions	Fig. 1 from Li et al., 2020
slow muscle cell ab-f59 labeling absent, abnormal	smyhc1^mb18/mb18	standard conditions	Fig. 2 from Li et al., 2020
muscle smyhc1 expression absent, abnormal	smyhc1^mb18/mb18	standard conditions	Fig. 1 from Li et al., 2020
whole organism myhz2 expression increased amount, abnormal	smyhc1^mb18/mb18	standard conditions	Fig. 1 from Li et al., 2020
slow muscle cell M band RFP expression absent, abnormal	smyhc1^mb17; myom3^mn0067Gt	standard conditions	Fig. 4, Fig. 12 from Li et al., 2020
slow muscle cell M band morphology, abnormal	smyhc1^mb17; myom3^mn0067Gt	standard conditions	Fig. 4, Fig. 12 from Li et al., 2020
slow muscle cell M band RFP expression spatial pattern, abnormal	smyhc1^mb17; myom3^mn0067Gt	standard conditions	Fig. 12 from Li et al., 2020
slow muscle cell M band absent, abnormal	smyhc1^mb17; myom3^mn0067Gt	standard conditions	Fig. 12 from Li et al., 2020

Citations