CRISPR

CRISPR3-cep55l

ID

ZDB-CRISPR-200812-3

Name

CRISPR3-cep55l

Previous Names

None

Target

cep55l (1)

Sequence

5' - CAGCAGTTGCGCTCCGCTCA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

The PAM site was "TGG" at the 3' end.

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
uy25	cep55l

Expression

Gene expression in Wild Types + CRISPR3-cep55l

No data available

Phenotype

Phenotype resulting from CRISPR3-cep55l

No data available

Phenotype of all Fish created by or utilizing CRISPR3-cep55l

Phenotype	Fish	Conditions	Figures
Meckel's cartilage anterior-posterior axis decreased distance ceratohyal cartilage, abnormal	cep55l^uy25/uy25	standard conditions	Fig. 3 from Yanagi et al., 2019
ventral mandibular arch dlx2a expression spatial pattern, abnormal	cep55l^uy25/uy25	standard conditions	Fig. 5 from Yanagi et al., 2019
retina morphology, abnormal	cep55l^uy25/uy25	standard conditions	Fig. 4 from Yanagi et al., 2019
brain dlx2a expression mislocalised, abnormal	cep55l^uy25/uy25	standard conditions	Fig. 5 from Yanagi et al., 2019
lens decreased diameter, abnormal	cep55l^uy25/uy25	standard conditions	Fig. 4 from Yanagi et al., 2019
cell death increased process quality, abnormal	cep55l^uy25/uy25	standard conditions	Fig. 2 from Yanagi et al., 2019
eye decreased size, abnormal	cep55l^uy25/uy25	standard conditions	Fig. 1 from Yanagi et al., 2019
retina decreased size, abnormal	cep55l^uy25/uy25	standard conditions	Fig. 3 from Yanagi et al., 2019
ventral mandibular arch disorganized, abnormal	cep55l^uy25/uy25	standard conditions	Fig. 1 from Yanagi et al., 2019
motor nucleus of vagal nerve EGFP expression spatial pattern, abnormal	cep55l^uy25/uy25; rw0Tg	standard conditions	Fig. 6 from Yanagi et al., 2019
trochlear motor nucleus EGFP expression spatial pattern, abnormal	cep55l^uy25/uy25; rw0Tg	standard conditions	Fig. 6 from Yanagi et al., 2019
motor nucleus of vagal nerve disorganized, abnormal	cep55l^uy25/uy25; rw0Tg	standard conditions	Fig. 6 from Yanagi et al., 2019
spinal cord motor neuron EGFP expression spatial pattern, abnormal	cep55l^uy25/uy25; rw0Tg	standard conditions	Fig. 6 from Yanagi et al., 2019
motor nucleus of vagal nerve decreased size, abnormal	cep55l^uy25/uy25; rw0Tg	standard conditions	Fig. 6 from Yanagi et al., 2019
trigeminal motor nucleus decreased size, abnormal	cep55l^uy25/uy25; rw0Tg	standard conditions	Fig. 6 from Yanagi et al., 2019
facial nerve motor nucleus decreased size, abnormal	cep55l^uy25/uy25; rw0Tg	standard conditions	Fig. 6 from Yanagi et al., 2019
facial nerve motor nucleus disorganized, abnormal	cep55l^uy25/uy25; rw0Tg	standard conditions	Fig. 6 from Yanagi et al., 2019
trochlear motor nucleus decreased size, abnormal	cep55l^uy25/uy25; rw0Tg	standard conditions	Fig. 6 from Yanagi et al., 2019
facial nerve motor nucleus EGFP expression spatial pattern, abnormal	cep55l^uy25/uy25; rw0Tg	standard conditions	Fig. 6 from Yanagi et al., 2019
trochlear motor nucleus disorganized, abnormal	cep55l^uy25/uy25; rw0Tg	standard conditions	Fig. 6 from Yanagi et al., 2019
retina morphology, abnormal	cep55l^uy25/uy25; rw0Tg	standard conditions	Fig. 6 from Yanagi et al., 2019
oculomotor nucleus disorganized, abnormal	cep55l^uy25/uy25; rw0Tg	standard conditions	Fig. 6 from Yanagi et al., 2019
trigeminal motor nucleus EGFP expression spatial pattern, abnormal	cep55l^uy25/uy25; rw0Tg	standard conditions	Fig. 6 from Yanagi et al., 2019
trigeminal motor nucleus disorganized, abnormal	cep55l^uy25/uy25; rw0Tg	standard conditions	Fig. 6 from Yanagi et al., 2019
oculomotor nucleus EGFP expression spatial pattern, abnormal	cep55l^uy25/uy25; rw0Tg	standard conditions	Fig. 6 from Yanagi et al., 2019
retina decreased size, abnormal	cep55l^uy25/uy25; rw0Tg	standard conditions	Fig. 6 from Yanagi et al., 2019
oculomotor nucleus decreased size, abnormal	cep55l^uy25/uy25; rw0Tg	standard conditions	Fig. 6 from Yanagi et al., 2019
cranial blood vessel EGFP expression spatial pattern, abnormal	cep55l^uy25; y1Tg	standard conditions	Fig. 6 from Yanagi et al., 2019
cranial blood vessel disorganized, abnormal	cep55l^uy25; y1Tg	standard conditions	Fig. 6 from Yanagi et al., 2019

Citations