CRISPR

CRISPR1-bach2a

ID

ZDB-CRISPR-200630-5

Name

CRISPR1-bach2a

Previous Names

None

Target

bach2a (1)

Sequence

5' - GGACGTCCTGTGTGACGTGA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
wz21	bach2a

Expression

Gene expression in Wild Types + CRISPR1-bach2a

No data available

Phenotype

Phenotype resulting from CRISPR1-bach2a

No data available

Phenotype of all Fish created by or utilizing CRISPR1-bach2a

Phenotype	Fish	Conditions	Figures
trunk has fewer parts of type vascular lymphangioblast, abnormal	bach2a^wz21/+; y1Tg + CRISPR1-bach2b	standard conditions	Fig. 3 from Cohen et al., 2020
trunk lymphatic endothelial cell differentiation decreased occurrence, abnormal	bach2a^wz21/+; y1Tg + CRISPR1-bach2b	standard conditions	Fig. 3 from Cohen et al., 2020
trunk has fewer parts of type vascular lymphangioblast, abnormal	bach2a^wz21/+; y1Tg + MO1-bach2b	standard conditions	Fig. 3 from Cohen et al., 2020
trunk lymphatic endothelial cell differentiation decreased occurrence, abnormal	bach2a^wz21/+; y1Tg + MO1-bach2b	standard conditions	Fig. 3 from Cohen et al., 2020
trunk lymphatic endothelial cell differentiation decreased occurrence, abnormal	bach2a^wz21/wz21; y1Tg + CRISPR1-bach2b	standard conditions	Fig. 3 from Cohen et al., 2020
trunk has fewer parts of type vascular lymphangioblast, abnormal	bach2a^wz21/wz21; y1Tg + CRISPR1-bach2b	standard conditions	Fig. 3 from Cohen et al., 2020
cranial blood vessel lacks all parts of type primordial hindbrain channel, abnormal	bach2a^wz21/wz21; y1Tg + CRISPR1-bach2b	standard conditions	Fig. 2 from Cohen et al., 2020
primordial hindbrain channel angiogenesis decreased process quality, abnormal	bach2a^wz21/wz21; y1Tg + CRISPR1-bach2b	standard conditions	Fig. 2 from Cohen et al., 2020
trunk lacks all parts of type thoracic duct, abnormal	bach2a^wz21/wz21; y1Tg + CRISPR1-bach2b	standard conditions	Fig. 4 from Cohen et al., 2020
thoracic duct lymphangiogenesis decreased process quality, abnormal	bach2a^wz21/wz21; y1Tg + CRISPR1-bach2b	standard conditions	Fig. 4 from Cohen et al., 2020
trunk lymphatic endothelial cell differentiation decreased occurrence, abnormal	bach2a^wz21/wz21; y1Tg + MO1-bach2b	standard conditions	Fig. 3 from Cohen et al., 2020
trunk has fewer parts of type vascular lymphangioblast, abnormal	bach2a^wz21/wz21; y1Tg + MO1-bach2b	standard conditions	Fig. 3 from Cohen et al., 2020
primordial hindbrain channel angiogenesis decreased process quality, abnormal	bach2a^wz21/wz21; y1Tg + MO1-bach2b	standard conditions	Fig. 2 from Cohen et al., 2020
cranial blood vessel lacks all parts of type primordial hindbrain channel, abnormal	bach2a^wz21/wz21; y1Tg + MO1-bach2b	standard conditions	Fig. 2 from Cohen et al., 2020
thoracic duct lymphangiogenesis decreased process quality, abnormal	bach2a^wz21/wz21; y1Tg + MO1-bach2b	standard conditions	Fig. 4 from Cohen et al., 2020
trunk lacks all parts of type thoracic duct, abnormal	bach2a^wz21/wz21; y1Tg + MO1-bach2b	standard conditions	Fig. 4 from Cohen et al., 2020

Citations