CRISPR

CRISPR2-scn1lab

ID
ZDB-CRISPR-200611-9
Name
CRISPR2-scn1lab
Previous Names
None
Target
Sequence
5' - CTGCGCCTTCATGACGCTCAG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
uio202 scn1lab
Expression
Gene expression in Wild Types + CRISPR2-scn1lab
No data available
Phenotype
Phenotype resulting from CRISPR2-scn1lab
No data available
Phenotype of all Fish created by or utilizing CRISPR2-scn1lab
Phenotype Fish Conditions Figures
swim bladder inflation decreased occurrence, abnormal scn1labuio202/uio202 (AB) standard conditions Fig. 1 with image from Tiraboschi et al., 2020
brain GABAergic neuron decreased amount, abnormal scn1labuio202/uio202 (AB) standard conditions Fig. 3 from Tiraboschi et al., 2020
brain glutamatergic neuron decreased amount, abnormal scn1labuio202/uio202 (AB) standard conditions Fig. 3 from Tiraboschi et al., 2020
optic tectum transmission of nerve impulse increased process quality, ameliorated scn1labuio202/uio202 (AB) chemical treatment: diazepam Fig. 1 with image from Tiraboschi et al., 2020
optic tectum transmission of nerve impulse increased process quality, abnormal scn1labuio202/uio202 (AB) standard conditions Fig. 1 with image from Tiraboschi et al., 2020
brain astrocyte activation increased occurrence, abnormal scn1labuio202/uio202 (AB) standard conditions Fig. 3 from Tiraboschi et al., 2020
optic tectum GABAergic neuron decreased branchiness, ameliorated scn1labuio202/uio202 (AB) chemical treatment: fenfluramine Fig. 4 with image from Tiraboschi et al., 2020
trunk bent, abnormal scn1labuio202/uio202 (AB) standard conditions Fig. 1 with image from Tiraboschi et al., 2020
optic tectum transmission of nerve impulse increased process quality, ameliorated scn1labuio202/uio202 (AB) chemical treatment: valproic acid Fig. 1 with image from Tiraboschi et al., 2020
optic tectum mitotic S phase increased occurrence, abnormal scn1labuio202/uio202 (AB) standard conditions Fig. 5 with image from Tiraboschi et al., 2020
brain slc17a7a expression increased amount, abnormal scn1labuio202/uio202 (AB) standard conditions Fig. 3 from Tiraboschi et al., 2020
brain gad1b expression increased amount, abnormal scn1labuio202/uio202 (AB) standard conditions Fig. 3 from Tiraboschi et al., 2020
pigmentation increased spatial extent of a process, abnormal scn1labuio202/uio202 (AB) standard conditions Fig. 1 with image from Tiraboschi et al., 2020
swim bladder uninflated, abnormal scn1labuio202/uio202 (AB) standard conditions Fig. 1 with image from Tiraboschi et al., 2020
optic tectum GABAergic neuron decreased branchiness, abnormal scn1labuio202/uio202 (AB) chemical treatment: diazepam Fig. 4 with image from Tiraboschi et al., 2020
optic tectum transmission of nerve impulse increased process quality, ameliorated scn1labuio202/uio202 (AB) chemical treatment: fenfluramine Fig. 1 with image from Tiraboschi et al., 2020
swimming increased occurrence, abnormal scn1labuio202/uio202 (AB) standard conditions Fig. S2 from Tiraboschi et al., 2020
optic tectum mitotic S phase normal occurrence, ameliorated scn1labuio202/uio202 (AB) chemical treatment: fenfluramine Fig. 5 with image from Tiraboschi et al., 2020
radial glial cell brain increased amount, abnormal scn1labuio202/uio202 (AB) standard conditions Fig. 2 from Tiraboschi et al., 2020
brain elavl3 expression increased amount, abnormal scn1labuio202/uio202 (AB) standard conditions Fig. 3 from Tiraboschi et al., 2020
optic tectum GABAergic neuron decreased branchiness, abnormal scn1labuio202/uio202 (AB) standard conditions Fig. 4 with image from Tiraboschi et al., 2020
Citations