CRISPR

CRISPR5-csf1rb

ID
ZDB-CRISPR-200427-5
Name
CRISPR5-csf1rb
Previous Names
None
Target
Sequence
5' - GTCTGTATGGTGAACATGAG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
mh108 csf1rb
mh112 csf1rb
Expression
Gene expression in Wild Types + CRISPR5-csf1rb
No data available
Phenotype
Phenotype resulting from CRISPR5-csf1rb
No data available
Phenotype of all Fish created by or utilizing CRISPR5-csf1rb
Phenotype Fish Conditions Figures
scale bone resorption decreased occurrence, abnormal csf1rbmh108/mh108 (AB) standard conditions Fig. 2 with image from Caetano-Lopes et al., 2020
scale csf1rb expression absent, abnormal csf1rbmh108/mh108 (AB) standard conditions Fig. 2 with image from Caetano-Lopes et al., 2020
centrum decreased volume, abnormal csf1rbmh108/mh108 (AB) standard conditions Fig. 3 with image from Caetano-Lopes et al., 2020
ceratobranchial 5 tooth basal surface osseous, abnormal csf1rbmh108/mh108 (AB) standard conditions Fig. 4 with image from Caetano-Lopes et al., 2020
centrum bone mineralization increased process quality, abnormal csf1rbmh108/mh108 (AB) standard conditions Fig. 3 with image from Caetano-Lopes et al., 2020
centrum increased mass density, abnormal csf1rbmh108/mh108 (AB) standard conditions Fig. 3 with image from Caetano-Lopes et al., 2020
neural arch dorsal orientation, abnormal csf1rbmh108/mh108 (AB) standard conditions Fig. 3 with image from Caetano-Lopes et al., 2020
neural arch decreased area, abnormal csf1rbmh112/mh112; csf1ramh5/mh5 (AB) standard conditions Fig. 3 with image from Caetano-Lopes et al., 2020
scale csf1rb expression absent, abnormal csf1rbmh112/mh112; csf1ramh5/mh5 (AB) standard conditions Fig. 2 with image from Caetano-Lopes et al., 2020
centrum decreased volume, abnormal csf1rbmh112/mh112; csf1ramh5/mh5 (AB) standard conditions Fig. 3 with image from Caetano-Lopes et al., 2020
scale bone resorption decreased occurrence, exacerbated csf1rbmh112/mh112; csf1ramh5/mh5 (AB) standard conditions Fig. 2 with image from Caetano-Lopes et al., 2020
integument has fewer parts of type melanocyte, abnormal csf1rbmh112/mh112; csf1ramh5/mh5 (AB) standard conditions Fig. 2 with image from Caetano-Lopes et al., 2020
scale csf1ra expression absent, abnormal csf1rbmh112/mh112; csf1ramh5/mh5 (AB) standard conditions Fig. 2 with image from Caetano-Lopes et al., 2020
ceratobranchial 5 bone has extra parts of type ceratobranchial 5 tooth, abnormal csf1rbmh112/mh112; csf1ramh5/mh5 (AB) standard conditions Fig. 4 with image from Caetano-Lopes et al., 2020
centrum increased mass density, exacerbated csf1rbmh112/mh112; csf1ramh5/mh5 (AB) standard conditions Fig. 3 with image from Caetano-Lopes et al., 2020
integument lacks all parts of type xanthophore, abnormal csf1rbmh112/mh112; csf1ramh5/mh5 (AB) standard conditions Fig. 2 with image from Caetano-Lopes et al., 2020
centrum increased diameter, abnormal csf1rbmh112/mh112; csf1ramh5/mh5 (AB) standard conditions Fig. 3 with image from Caetano-Lopes et al., 2020
pigment cell development decreased process quality, abnormal csf1rbmh112/mh112; csf1ramh5/mh5 (AB) standard conditions Fig. 2 with image from Caetano-Lopes et al., 2020
ceratobranchial 5 bone odontogenesis increased occurrence, abnormal csf1rbmh112/mh112; csf1ramh5/mh5 (AB) standard conditions Fig. 4 with image from Caetano-Lopes et al., 2020
neural arch dorsal orientation, abnormal csf1rbmh112/mh112; csf1ramh5/mh5 (AB) standard conditions Fig. 3 with image from Caetano-Lopes et al., 2020
centrum bone mineralization increased process quality, exacerbated csf1rbmh112/mh112; csf1ramh5/mh5 (AB) standard conditions Fig. 3 with image from Caetano-Lopes et al., 2020
Citations