CRISPR

CRISPR1-fabp2

ID

ZDB-CRISPR-200413-1

Name

CRISPR1-fabp2

Previous Names

None

Target

fabp2 (1)

Sequence

5' - ACAGTCAGGACTATCGTTAA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
zf3195	fabp2

Expression

Gene expression in Wild Types + CRISPR1-fabp2

No data available

Phenotype

Phenotype resulting from CRISPR1-fabp2

No data available

Phenotype of all Fish created by or utilizing CRISPR1-fabp2

Phenotype	Fish	Conditions	Figures
intestine cpt1aa expression decreased amount, abnormal	fabp2^{zf3195/zf3195} (AB)	standard conditions	Fig. 4 from Zhao et al., 2020
intestine acat1 expression decreased amount, abnormal	fabp2^{zf3195/zf3195} (AB)	standard conditions	Fig. 4 from Zhao et al., 2020
intestine all-cis-5,8,11,14,17-icosapentaenoic acid decreased amount, abnormal	fabp2^{zf3195/zf3195} (AB)	standard conditions	Fig. 2 from Zhao et al., 2020
intestine agpat2 expression increased amount, abnormal	fabp2^{zf3195/zf3195} (AB)	standard conditions	Fig. 4 from Zhao et al., 2020
liver pparg expression increased amount, abnormal	fabp2^{zf3195/zf3195} (AB)	standard conditions	Fig. 4 from Zhao et al., 2020
liver low-density lipoprotein cholesterol increased amount, abnormal	fabp2^{zf3195/zf3195} (AB)	standard conditions	Fig. 2 from Zhao et al., 2020
intestine got2a expression decreased amount, abnormal	fabp2^{zf3195/zf3195} (AB)	standard conditions	Fig. 4 from Zhao et al., 2020
intestine triglyceride increased amount, abnormal	fabp2^{zf3195/zf3195} (AB)	standard conditions	Fig. 2 from Zhao et al., 2020
intestine all-cis-docosa-4,7,10,13,16,19-hexaenoic acid decreased amount, abnormal	fabp2^{zf3195/zf3195} (AB)	standard conditions	Fig. 2 from Zhao et al., 2020
blood plasma triglyceride increased amount, abnormal	fabp2^{zf3195/zf3195} (AB)	standard conditions	Fig. 2 from Zhao et al., 2020
intestine slc27a4 expression decreased amount, abnormal	fabp2^{zf3195/zf3195} (AB)	standard conditions	Fig. 4 from Zhao et al., 2020
liver pparaa expression increased amount, abnormal	fabp2^{zf3195/zf3195} (AB)	standard conditions	Fig. 4 from Zhao et al., 2020
intestine fatty acid composition, abnormal	fabp2^{zf3195/zf3195} (AB)	standard conditions	Fig. 2 from Zhao et al., 2020
intestine saturated fatty acid increased amount, abnormal	fabp2^{zf3195/zf3195} (AB)	standard conditions	Fig. 2 from Zhao et al., 2020
intestine ldlra expression increased amount, abnormal	fabp2^{zf3195/zf3195} (AB)	standard conditions	Fig. 4 from Zhao et al., 2020
intestine fabp1a expression increased amount, abnormal	fabp2^{zf3195/zf3195} (AB)	standard conditions	Fig. 4 from Zhao et al., 2020
liver phosphatidylinositol increased amount, abnormal	fabp2^{zf3195/zf3195} (AB)	standard conditions	Fig. 2 from Zhao et al., 2020
blood plasma low-density lipoprotein cholesterol increased amount, abnormal	fabp2^{zf3195/zf3195} (AB)	standard conditions	Fig. 2 from Zhao et al., 2020
intestine abca1a expression decreased amount, abnormal	fabp2^{zf3195/zf3195} (AB)	standard conditions	Fig. 4 from Zhao et al., 2020
liver cholesteryl ester increased amount, abnormal	fabp2^{zf3195/zf3195} (AB)	standard conditions	Fig. 2 from Zhao et al., 2020
liver increased accumulation hepatocyte fatty acid, abnormal	fabp2^{zf3195/zf3195} (AB)	standard conditions	Fig. 2 from Zhao et al., 2020
intestine dgat2 expression increased amount, abnormal	fabp2^{zf3195/zf3195} (AB)	standard conditions	Fig. 4 from Zhao et al., 2020
liver high-density lipoprotein cholesterol increased amount, abnormal	fabp2^{zf3195/zf3195} (AB)	standard conditions	Fig. 2 from Zhao et al., 2020
intestine cd36 expression decreased amount, abnormal	fabp2^{zf3195/zf3195} (AB)	standard conditions	Fig. 4 from Zhao et al., 2020
liver triglyceride increased amount, abnormal	fabp2^{zf3195/zf3195} (AB)	standard conditions	Fig. 2 from Zhao et al., 2020
intestine hmgcra expression increased amount, abnormal	fabp2^{zf3195/zf3195} (AB)	standard conditions	Fig. 4 from Zhao et al., 2020
intestine abca1b expression decreased amount, abnormal	fabp2^{zf3195/zf3195} (AB)	standard conditions	Fig. 4 from Zhao et al., 2020
liver srebf1 expression increased amount, abnormal	fabp2^{zf3195/zf3195} (AB)	standard conditions	Fig. 4 from Zhao et al., 2020

Citations