CRISPR

CRISPR1-narfl

ID
ZDB-CRISPR-200103-1
Name
CRISPR1-narfl
Previous Names
None
Target
Sequence
5' - ATGTTGGCGTCTGCATGTCC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site was "AGG" at the 3' end.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
ihb379 narfl
Expression
Gene expression in Wild Types + CRISPR1-narfl
No data available
Phenotype
Phenotype resulting from CRISPR1-narfl
No data available
Phenotype of all Fish created by or utilizing CRISPR1-narfl
Phenotype Fish Conditions Figures
whole organism kdr expression increased amount, abnormal narflihb379/ihb379 standard conditions Fig. 5 from Luo et al., 2019
intestine fabp1a expression spatial pattern, abnormal narflihb379/ihb379 standard conditions Fig. 3 from Luo et al., 2019
whole organism bmp2b expression increased amount, abnormal narflihb379/ihb379 standard conditions Fig. 5 from Luo et al., 2019
aconitate hydratase activity decreased efficacy, abnormal narflihb379/ihb379 standard conditions Fig. 1 from Luo et al., 2019
adenylyl-sulfate reductase (glutathione) activity decreased efficacy, abnormal narflihb379/ihb379 standard conditions Fig. 4 from Luo et al., 2019
intestine fabp1a expression decreased amount, abnormal narflihb379/ihb379 standard conditions Fig. 3 from Luo et al., 2019
whole organism bmp7b expression increased amount, abnormal narflihb379/ihb379 standard conditions Fig. 5 from Luo et al., 2019
superoxide dismutase activity decreased efficacy, abnormal narflihb379/ihb379 standard conditions Fig. 4 from Luo et al., 2019
whole organism hkdc1 expression increased amount, abnormal narflihb379/ihb379 standard conditions Fig. 5 from Luo et al., 2019
liver ela2l expression spatial pattern, abnormal narflihb379/ihb379 standard conditions Fig. 3 from Luo et al., 2019
whole organism hif1ab expression increased amount, abnormal narflihb379/ihb379 standard conditions Fig. 4 from Luo et al., 2019
whole organism gck expression increased amount, abnormal narflihb379/ihb379 standard conditions Fig. 5 from Luo et al., 2019
blood vessel development hypertrophic growth, ameliorated narflihb379/ihb379 chemical treatment: 2-methoxy-17beta-estradiol Fig. 5 from Luo et al., 2019
intestine hif1ab expression increased distribution, abnormal narflihb379/ihb379 standard conditions Fig. 4 from Luo et al., 2019
digestive system compound organ morphology, abnormal narflihb379/ihb379 standard conditions Fig. 3 from Luo et al., 2019
liver ela2l expression decreased amount, abnormal narflihb379/ihb379 standard conditions Fig. 3 from Luo et al., 2019
blood vessel development hypertrophic growth, abnormal narflihb379/ihb379 standard conditions Fig. 5 from Luo et al., 2019
exocrine pancreas fabp2 expression decreased amount, abnormal narflihb379/ihb379 standard conditions Fig. 3 from Luo et al., 2019
whole organism pdgfrb expression increased amount, abnormal narflihb379/ihb379 standard conditions Fig. 5 from Luo et al., 2019
whole organism angpt1 expression increased amount, abnormal narflihb379/ihb379 standard conditions Fig. 5 from Luo et al., 2019
whole organism tek expression increased amount, abnormal narflihb379/ihb379 standard conditions Fig. 5 from Luo et al., 2019
whole organism vegfab expression increased amount, abnormal narflihb379/ihb379 standard conditions Fig. 5 from Luo et al., 2019
whole organism bmp16 expression increased amount, abnormal narflihb379/ihb379 standard conditions Fig. 5 from Luo et al., 2019
glutathione synthase activity decreased efficacy, abnormal narflihb379/ihb379 standard conditions Fig. 4 from Luo et al., 2019
exocrine pancreas fabp2 expression spatial pattern, abnormal narflihb379/ihb379 standard conditions Fig. 3 from Luo et al., 2019
whole organism aldoca expression increased amount, abnormal narflihb379/ihb379 standard conditions Fig. 5 from Luo et al., 2019
blood vessel development hypertrophic growth, abnormal narflihb379/ihb379; y1Tg standard conditions Fig. 2 from Luo et al., 2019
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.