CRISPR

CRISPR13-foxc1a

ID

ZDB-CRISPR-200102-2

Name

CRISPR13-foxc1a

Previous Names

None

Target

foxc1a (1)

Sequence

5' - CCGCCGCCGGAGGGGGGTACACC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
ua1017	foxc1a

Expression

Gene expression in Wild Types + CRISPR13-foxc1a

No data available

Phenotype

Phenotype resulting from CRISPR13-foxc1a

No data available

Phenotype of all Fish created by or utilizing CRISPR13-foxc1a

Phenotype	Fish	Conditions	Figures
aortic arch myl9a expression decreased amount, abnormal	foxc1a^{ua1017/ua1017}	standard conditions	Fig. 8 from Whitesell et al., 2019
heart edematous, abnormal	foxc1a^{ua1017/ua1017}	standard conditions	Fig. S11 from Whitesell et al., 2019
vascular associated smooth muscle cell foxc1b expression decreased amount, abnormal	foxc1a^{ua1017/ua1017}	standard conditions	Fig. 8 from Whitesell et al., 2019
pericyte pdgfrb expression decreased amount, abnormal	foxc1a^{ua1017/ua1017}	standard conditions	Fig. 8 from Whitesell et al., 2019
vascular associated smooth muscle cell foxc1a expression decreased amount, abnormal	foxc1a^{ua1017/ua1017}	standard conditions	Fig. 8 from Whitesell et al., 2019
vascular associated smooth muscle cell acta2 expression decreased amount, abnormal	foxc1a^{ua1017/ua1017}	standard conditions	Fig. 8 from Whitesell et al., 2019
whole organism col1a1a expression decreased amount, abnormal	foxc1a^{ua1017/ua1017} (AB)	standard conditions	Figure 7 from Hawkey-Noble et al., 2022
whole organism col11a2 expression decreased amount, abnormal	foxc1a^{ua1017/ua1017} (AB)	standard conditions	Figure 7 from Hawkey-Noble et al., 2022
vertebra ossification absent process, abnormal	foxc1a^{ua1017/ua1017} (AB)	standard conditions	Figure 6 from Hawkey-Noble et al., 2022
head deformed, abnormal	foxc1a^{ua1017/ua1017} (AB)	standard conditions	Figure 2 from Chrystal et al., 2021
determination of heart left/right asymmetry disrupted, abnormal	foxc1a^{ua1017/ua1017} (AB)	standard conditions	Figure 3 from Chrystal et al., 2021
brain hemorrhagic, abnormal	foxc1a^{ua1017/ua1017} (AB)	standard conditions	Figure 2 from Chrystal et al., 2021
opercular flap ossification decreased process quality, abnormal	foxc1a^{ua1017/ua1017} (AB)	standard conditions	Figure 4 from Hawkey-Noble et al., 2022
pericardium edematous, abnormal	foxc1a^{ua1017/ua1017} (AB)	standard conditions	Figure 2 from Chrystal et al., 2021
whole organism hpxa expression decreased amount, abnormal	foxc1a^{ua1017/ua1017} (AB)	standard conditions	Figure 7 from Hawkey-Noble et al., 2022
lateral plate mesoderm lft2 expression spatial pattern, abnormal	foxc1a^{ua1017/ua1017} (AB)	standard conditions	Figure 6 from Chrystal et al., 2021
pharyngeal arch 1 ossification decreased process quality, abnormal	foxc1a^{ua1017/ua1017} (AB)	standard conditions	Figure 4 from Hawkey-Noble et al., 2022
heart myl7 expression spatial pattern, abnormal	foxc1a^{ua1017/ua1017} (AB)	standard conditions	Figure 3 from Chrystal et al., 2021
eye decreased size, abnormal	foxc1a^{ua1017/ua1017} (AB)	standard conditions	Figure 2 from Chrystal et al., 2021
pharyngeal arch 2 ossification decreased process quality, abnormal	foxc1a^{ua1017/ua1017} (AB)	standard conditions	Figure 4 from Hawkey-Noble et al., 2022
whole organism matn1 expression decreased amount, abnormal	foxc1a^{ua1017/ua1017} (AB)	standard conditions	Figure 7 from Hawkey-Noble et al., 2022
ventral aorta decreased length, abnormal	foxc1a^{ua1017/ua1017}; ca7Tg/+; ci5Tg/+	standard conditions	Fig. 8 from Whitesell et al., 2019
heart edematous, abnormal	foxc1a^{ua1017/ua1017}; foxc1b^ua1018/+	standard conditions	Fig. S11 from Whitesell et al., 2019
ventral aorta vascular associated smooth muscle cell decreased amount, abnormal	foxc1a^{ua1017/ua1017}; foxc1b^ua1018/+; ca7Tg/+; ci5Tg/+	standard conditions	Fig. 8 from Whitesell et al., 2019
aortic arch myl9a expression decreased amount, abnormal	foxc1a^{ua1017/ua1017}; foxc1b^{ua1018/ua1018}	standard conditions	Fig. 8 from Whitesell et al., 2019
heart edematous, abnormal	foxc1a^{ua1017/ua1017}; foxc1b^{ua1018/ua1018}	standard conditions	Fig. S11 from Whitesell et al., 2019
vascular associated smooth muscle cell foxc1b expression decreased amount, abnormal	foxc1a^{ua1017/ua1017}; foxc1b^{ua1018/ua1018}	standard conditions	Fig. 8 from Whitesell et al., 2019
pericyte pdgfrb expression decreased amount, abnormal	foxc1a^{ua1017/ua1017}; foxc1b^{ua1018/ua1018}	standard conditions	Fig. 8 from Whitesell et al., 2019
vascular associated smooth muscle cell foxc1a expression decreased amount, abnormal	foxc1a^{ua1017/ua1017}; foxc1b^{ua1018/ua1018}	standard conditions	Fig. 8 from Whitesell et al., 2019
vascular associated smooth muscle cell acta2 expression decreased amount, abnormal	foxc1a^{ua1017/ua1017}; foxc1b^{ua1018/ua1018}	standard conditions	Fig. 8 from Whitesell et al., 2019
heart myl7 expression spatial pattern, abnormal	foxc1a^{ua1017/ua1017}; foxc1b^{ua1018/ua1018} (AB)	standard conditions	Figure 3 from Chrystal et al., 2021
brain ventricular system swollen, abnormal	foxc1a^{ua1017/ua1017}; foxc1b^{ua1018/ua1018} (AB)	standard conditions	Figure 2 from Chrystal et al., 2021
head deformed, abnormal	foxc1a^{ua1017/ua1017}; foxc1b^{ua1018/ua1018} (AB)	standard conditions	Figure 2 from Chrystal et al., 2021
determination of pancreatic left/right asymmetry disrupted, abnormal	foxc1a^{ua1017/ua1017}; foxc1b^{ua1018/ua1018} (AB)	standard conditions	Figure 3 from Chrystal et al., 2021
determination of heart left/right asymmetry disrupted, abnormal	foxc1a^{ua1017/ua1017}; foxc1b^{ua1018/ua1018} (AB)	standard conditions	Figure 3 from Chrystal et al., 2021
brain hemorrhagic, abnormal	foxc1a^{ua1017/ua1017}; foxc1b^{ua1018/ua1018} (AB)	standard conditions	Figure 2 from Chrystal et al., 2021
pericardium edematous, abnormal	foxc1a^{ua1017/ua1017}; foxc1b^{ua1018/ua1018} (AB)	standard conditions	Figure 4 from Hawkey-Noble et al., 2022 Figure 2 from Chrystal et al., 2021
opercular flap ossification decreased process quality, abnormal	foxc1a^{ua1017/ua1017}; foxc1b^{ua1018/ua1018} (AB)	standard conditions	Figure 4 from Hawkey-Noble et al., 2022
determination of liver left/right asymmetry disrupted, abnormal	foxc1a^{ua1017/ua1017}; foxc1b^{ua1018/ua1018} (AB)	standard conditions	Figure 3 from Chrystal et al., 2021
lateral plate mesoderm lft2 expression spatial pattern, abnormal	foxc1a^{ua1017/ua1017}; foxc1b^{ua1018/ua1018} (AB)	standard conditions	Figure 6 from Chrystal et al., 2021
pancreas foxa3 expression spatial pattern, abnormal	foxc1a^{ua1017/ua1017}; foxc1b^{ua1018/ua1018} (AB)	standard conditions	Figure 3 from Chrystal et al., 2021
pharyngeal arch 1 ossification decreased process quality, abnormal	foxc1a^{ua1017/ua1017}; foxc1b^{ua1018/ua1018} (AB)	standard conditions	Figure 4 from Hawkey-Noble et al., 2022
eye decreased size, abnormal	foxc1a^{ua1017/ua1017}; foxc1b^{ua1018/ua1018} (AB)	standard conditions	Figure 2 from Chrystal et al., 2021
pharyngeal arch 2 ossification decreased process quality, abnormal	foxc1a^{ua1017/ua1017}; foxc1b^{ua1018/ua1018} (AB)	standard conditions	Figure 4 from Hawkey-Noble et al., 2022
liver foxa3 expression spatial pattern, abnormal	foxc1a^{ua1017/ua1017}; foxc1b^{ua1018/ua1018} (AB)	standard conditions	Figure 3 from Chrystal et al., 2021
ventral aorta vascular associated smooth muscle cell decreased amount, abnormal	foxc1a^{ua1017/ua1017}; foxc1b^{ua1018/ua1018}; ca7Tg/+; ci5Tg/+	standard conditions	Fig. 8 from Whitesell et al., 2019
pharyngeal arch 2 ossification decreased process quality, abnormal	foxc1a^{ua1017/ua1017}; foxl1^nfl1/nfl1 (AB)	standard conditions	Figure 4 from Hawkey-Noble et al., 2022
cranial cartilage ossification absent process, abnormal	foxc1a^{ua1017/ua1017}; foxl1^nfl1/nfl1 (AB)	standard conditions	Figure 6 from Hawkey-Noble et al., 2022
vertebra ossification absent process, abnormal	foxc1a^{ua1017/ua1017}; foxl1^nfl1/nfl1 (AB)	standard conditions	Figure 6 from Hawkey-Noble et al., 2022
opercular flap ossification decreased process quality, abnormal	foxc1a^{ua1017/ua1017}; foxl1^nfl1/nfl1 (AB)	standard conditions	Figure 4 from Hawkey-Noble et al., 2022
pericardium edematous, abnormal	foxc1a^{ua1017/ua1017}; foxl1^nfl1/nfl1 (AB)	standard conditions	Figure 4 from Hawkey-Noble et al., 2022
pharyngeal arch 1 ossification decreased process quality, abnormal	foxc1a^{ua1017/ua1017}; foxl1^nfl1/nfl1 (AB)	standard conditions	Figure 4 from Hawkey-Noble et al., 2022
coelom edematous, abnormal	foxc1a^{ua1017/ua1017}; foxl1^nfl1/nfl1 (AB)	standard conditions	Figure 6 from Hawkey-Noble et al., 2022

Citations