CRISPR

CRISPR1-cnr2

ID

ZDB-CRISPR-191031-13

Name

CRISPR1-cnr2

Previous Names

None

Target

cnr2 (1)

Sequence

5' - ATGGCGTTTACGGGCTCTGT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
upr1	cnr2

Expression

Gene expression in Wild Types + CRISPR1-cnr2

No data available

Phenotype

Phenotype resulting from CRISPR1-cnr2

No data available

Phenotype of all Fish created by or utilizing CRISPR1-cnr2

Phenotype	Fish	Conditions	Figures
response to absence of light increased occurrence, abnormal	cnr2^upr1/upr1 (NHGRI-1)	chemical treatment: [6-iodo-2-methyl-1-[2-(4-morpholinyl)ethyl]-3-indolyl]-(4-methoxyphenyl)methanone	Fig. 5 from Acevedo-Canabal et al., 2019
response to light stimulus decreased occurrence, abnormal	cnr2^upr1/upr1 (NHGRI-1)	control	Fig. 2, Fig. 3, Fig. 4, Fig. 5 from Acevedo-Canabal et al., 2019
locomotory exploration behavior decreased occurrence, abnormal	cnr2^upr1/upr1 (NHGRI-1)	control	Fig. 2, Fig. 3, Fig. 5 from Acevedo-Canabal et al., 2019
locomotory exploration behavior decreased occurrence, abnormal	cnr2^upr1/upr1 (NHGRI-1)	chemical treatment: HU-308	Fig. 5 from Acevedo-Canabal et al., 2019
locomotory exploration behavior decreased occurrence, abnormal	cnr2^upr1/upr1 (NHGRI-1)	chemical treatment: JWH-133	Fig. 5 from Acevedo-Canabal et al., 2019
swimming behavior occurrence, abnormal	cnr2^upr1/upr1 (NHGRI-1)	standard conditions	Fig. 2 from Acevedo-Canabal et al., 2019
response to absence of light increased occurrence, abnormal	cnr2^upr1/upr1 (NHGRI-1)	chemical treatment: JWH-133	Fig. 5 from Acevedo-Canabal et al., 2019
locomotory exploration behavior decreased occurrence, exacerbated	cnr2^upr1/upr1 (NHGRI-1)	chemical treatment: pentetrazol	Fig. 4 from Acevedo-Canabal et al., 2019
response to light stimulus decreased occurrence, abnormal	cnr2^upr1/upr1 (NHGRI-1)	chemical treatment: HU-308	Fig. 5 from Acevedo-Canabal et al., 2019
response to light stimulus decreased occurrence, abnormal	cnr2^upr1/upr1 (NHGRI-1)	chemical treatment: SR 144528	Fig. 5 from Acevedo-Canabal et al., 2019
response to light stimulus increased occurrence, exacerbated	cnr2^upr1/upr1 (NHGRI-1)	chemical treatment: pentetrazol	Fig. 4 from Acevedo-Canabal et al., 2019
response to absence of light increased occurrence, abnormal	cnr2^upr1/upr1 (NHGRI-1)	chemical treatment: HU-308	Fig. 5 from Acevedo-Canabal et al., 2019
swimming behavior increased occurrence, exacerbated	cnr2^upr1/upr1 (NHGRI-1)	chemical treatment: pentetrazol	Fig. 4 from Acevedo-Canabal et al., 2019
response to light stimulus decreased occurrence, abnormal	cnr2^upr1/upr1 (NHGRI-1)	chemical treatment: JWH-133	Fig. 5 from Acevedo-Canabal et al., 2019
response to absence of light increased occurrence, ameliorated	cnr2^upr1/upr1 (NHGRI-1)	chemical treatment: valproic acid	Fig. 3 from Acevedo-Canabal et al., 2019
locomotory exploration behavior decreased occurrence, exacerbated	cnr2^upr1/upr1 (NHGRI-1)	chemical treatment: valproic acid	Fig. 3 from Acevedo-Canabal et al., 2019
response to light stimulus decreased occurrence, abnormal	cnr2^upr1/upr1 (NHGRI-1)	chemical treatment: valproic acid	Fig. 3 from Acevedo-Canabal et al., 2019
response to absence of light increased occurrence, abnormal	cnr2^upr1/upr1 (NHGRI-1)	control	Fig. 2, Fig. 3, Fig. 5 from Acevedo-Canabal et al., 2019

Citations