CRISPR

CRISPR1-cdk1

ID
ZDB-CRISPR-190906-2
Name
CRISPR1-cdk1
Previous Names
None
Target
Sequence
5' - GGTCTATTTCGGAGTCTCCA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
tju1 cdk1
Expression
Gene expression in Wild Types + CRISPR1-cdk1
No data available
Phenotype
Phenotype resulting from CRISPR1-cdk1
No data available
Phenotype of all Fish created by or utilizing CRISPR1-cdk1
Phenotype Fish Conditions Figures
eye decreased size, abnormal cdk1tju1/tju1 (TU) standard conditions Fig. 1 from Jin et al., 2021
Fig. 1,  Fig. S2 from Hu et al., 2019
retina mitotic S phase decreased occurrence, abnormal cdk1tju1/tju1 (TU) standard conditions Fig. 4,  Fig. S3 from Jin et al., 2021
retina apoptotic, abnormal cdk1tju1/tju1 (TU) standard conditions Fig. S2 from Jin et al., 2021
eye cdk1 expression decreased amount, abnormal cdk1tju1/tju1 (TU) standard conditions Fig. S5 from Hu et al., 2019
axis curved dorsal, abnormal cdk1tju1/tju1 (TU) standard conditions Fig. S2 from Hu et al., 2019
retinal cone cell decreased amount, abnormal cdk1tju1/tju1 (TU) standard conditions Fig. S2 from Jin et al., 2021
neural tube mitotic S phase decreased occurrence, abnormal cdk1tju1/tju1 (TU) standard conditions Fig. S3 from Jin et al., 2021
photoreceptor cell zpr-3 labeling decreased amount, abnormal cdk1tju1/tju1 (TU) standard conditions Fig. S2 from Jin et al., 2021
retina site of double-strand break increased amount, abnormal cdk1tju1/tju1 (TU) standard conditions Fig. 4 from Jin et al., 2021
whole organism cdk1 expression decreased amount, abnormal cdk1tju1/tju1 (TU) standard conditions Fig. 1,  Fig. S1 from Jin et al., 2021
retina cell division decreased occurrence, abnormal cdk1tju1/tju1 (TU) standard conditions Fig. 3 from Jin et al., 2021
photoreceptor cell zpr-1 labeling decreased amount, abnormal cdk1tju1/tju1 (TU) standard conditions Fig. S2 from Jin et al., 2021
retina cell division increased spatial extent of a process, abnormal cdk1tju1/tju1 (TU) standard conditions Fig. 2 from Jin et al., 2021
retina basal side proliferative, abnormal cdk1tju1/tju1 (TU) standard conditions Fig. 2 from Jin et al., 2021
retinal rod cell decreased amount, abnormal cdk1tju1/tju1 (TU) standard conditions Fig. S2 from Jin et al., 2021
retina mitotic M phase arrested, abnormal cdk1tju1/tju1 (TU) standard conditions Fig. 3 from Jin et al., 2021
retina somatic stem cell col15a1b expression decreased amount, abnormal cdk1tju1/tju1 (TU) standard conditions Fig. 1 from Jin et al., 2021
retina mitotic spindle direction, abnormal cdk1tju1/tju1 (TU) standard conditions Fig. 2 from Jin et al., 2021
trunk curved dorsal, abnormal cdk1tju1/tju1 (TU) standard conditions Fig. S2 from Hu et al., 2019
pericardium edematous, abnormal cdk1tju1/tju1 (TU) standard conditions Fig. S2 from Hu et al., 2019
amacrine cell decreased amount, abnormal cdk1tju1/tju1; cu2Tg; jh1Tg standard conditions Fig. S2 from Jin et al., 2021
retinal ganglion cell decreased amount, abnormal cdk1tju1/tju1; cu2Tg; jh1Tg standard conditions Fig. S2 from Jin et al., 2021
horizontal cell decreased amount, abnormal cdk1tju1/tju1; cu2Tg; jh1Tg standard conditions Fig. S2 from Jin et al., 2021
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.