CRISPR

CRISPR2-cpt1b

ID

ZDB-CRISPR-190830-1

Name

CRISPR2-cpt1b

Previous Names

None

Target

cpt1b (1)

Sequence

5' - TGTATGCCAGGATCGACCCC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
ecn1	cpt1b
ecn2	cpt1b

Expression

Gene expression in Wild Types + CRISPR2-cpt1b

No data available

Phenotype

Phenotype resulting from CRISPR2-cpt1b

No data available

Phenotype of all Fish created by or utilizing CRISPR2-cpt1b

Phenotype	Fish	Conditions	Figures
whole organism protein increased amount, abnormal	cpt1b^ecn2/ecn2	standard conditions	Fig. 6 from Li et al., 2020
whole organism bcat2 expression decreased amount, abnormal	cpt1b^ecn2/ecn2	standard conditions	Fig. 6 from Li et al., 2020
whole organism increased weight, abnormal	cpt1b^ecn2/ecn2	standard conditions	Table 2 from Li et al., 2020
muscle acetyl-CoA increased amount, abnormal	cpt1b^ecn2/ecn2	standard conditions	Fig. S8 from Li et al., 2020
liver gys2 expression decreased amount, abnormal	cpt1b^ecn2/ecn2	standard conditions	Fig. S8 from Li et al., 2020
muscle lysine increased amount, abnormal	cpt1b^ecn2/ecn2	standard conditions	Fig. S9 from Li et al., 2020
whole organism asns expression decreased amount, abnormal	cpt1b^ecn2/ecn2	standard conditions	Fig. 6 from Li et al., 2020
liver fatty acid oxidation process quality, abnormal	cpt1b^ecn2/ecn2	standard conditions	Fig. 6 from Li et al., 2020
liver gck expression increased amount, abnormal	cpt1b^ecn2/ecn2	standard conditions	Fig. S8 from Li et al., 2020
muscle leucine increased amount, abnormal	cpt1b^ecn2/ecn2	standard conditions	Fig. S9 from Li et al., 2020
muscle slc2a2 expression increased amount, abnormal	cpt1b^ecn2/ecn2	standard conditions	Fig. S8 from Li et al., 2020
muscle fatty, abnormal	cpt1b^ecn2/ecn2	standard conditions	Fig. 6 from Li et al., 2020
oxygen metabolic process process quality, abnormal	cpt1b^ecn2/ecn2	standard conditions	Fig. S6 from Li et al., 2020
liver dgat2 expression increased amount, abnormal	cpt1b^ecn2/ecn2	standard conditions	Fig. S7 from Li et al., 2020
muscle glycogen decreased amount, abnormal	cpt1b^ecn2/ecn2	standard conditions	Fig. 6 from Li et al., 2020
muscle fatty acid beta-oxidation decreased occurrence, abnormal	cpt1b^ecn2/ecn2	standard conditions	Fig. 3 from Lu et al., 2019
liver mitochondrion increased amount, abnormal	cpt1b^ecn2/ecn2	standard conditions	Fig. S7 from Li et al., 2020
whole organism viability, exacerbated	cpt1b^ecn2/ecn2	cold exposure	Fig. 3 from Lu et al., 2019
liver pck1 expression decreased amount, abnormal	cpt1b^ecn2/ecn2	standard conditions	Fig. S8 from Li et al., 2020
liver acox3 expression increased amount, abnormal	cpt1b^ecn2/ecn2	standard conditions	Fig. S7 from Li et al., 2020
liver g6pc1a.2 expression decreased amount, abnormal	cpt1b^ecn2/ecn2	standard conditions	Fig. S8 from Li et al., 2020
muscle valine increased amount, abnormal	cpt1b^ecn2/ecn2	standard conditions	Fig. S9 from Li et al., 2020
whole organism glud1a expression decreased amount, abnormal	cpt1b^ecn2/ecn2	standard conditions	Fig. 6 from Li et al., 2020
muscle pck1 expression decreased amount, abnormal	cpt1b^ecn2/ecn2	standard conditions	Fig. S8 from Li et al., 2020
liver fatty, abnormal	cpt1b^ecn2/ecn2	standard conditions	Fig. 6, Fig. S6 from Li et al., 2020
liver slc2a2 expression increased amount, abnormal	cpt1b^ecn2/ecn2	standard conditions	Fig. S8 from Li et al., 2020
whole organism anpepb.1 expression decreased amount, abnormal	cpt1b^ecn2/ecn2	standard conditions	Fig. 6 from Li et al., 2020
liver pfklb expression decreased amount, abnormal	cpt1b^ecn2/ecn2	standard conditions	Fig. S8 from Li et al., 2020
whole organism viability, exacerbated	cpt1b^ecn2/ecn2	cold exposure, fasting	Fig. 3 from Lu et al., 2019
liver fasn expression increased amount, abnormal	cpt1b^ecn2/ecn2	standard conditions	Fig. S7 from Li et al., 2020
muscle pyruvate increased amount, abnormal	cpt1b^ecn2/ecn2	standard conditions	Fig. S8 from Li et al., 2020
muscle fatty acid oxidation process quality, abnormal	cpt1b^ecn2/ecn2	standard conditions	Fig. 6 from Li et al., 2020
liver glycogen decreased amount, abnormal	cpt1b^ecn2/ecn2	standard conditions	Fig. 6 from Li et al., 2020
liver srebf1 expression increased amount, abnormal	cpt1b^ecn2/ecn2	standard conditions	Fig. S7 from Li et al., 2020
swimming behavior process quality, abnormal	cpt1b^ecn2/ecn2	standard conditions	Fig. S6 from Li et al., 2020
whole organism bckdha expression decreased amount, abnormal	cpt1b^ecn2/ecn2	standard conditions	Fig. 6 from Li et al., 2020
liver fatty acid beta-oxidation decreased occurrence, abnormal	cpt1b^ecn2/ecn2	standard conditions	Fig. 3 from Lu et al., 2019

Citations