CRISPR

CRISPR1-dram1

ID
ZDB-CRISPR-190711-1
Name
CRISPR1-dram1
Previous Names
None
Target
Sequence
5' - GACCAGATAACCAGGAAAGTT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
ibl53 dram1
Expression
Gene expression in Wild Types + CRISPR1-dram1
No data available
Phenotype
Phenotype resulting from CRISPR1-dram1
No data available
Phenotype of all Fish created by or utilizing CRISPR1-dram1
Phenotype Fish Conditions Figures
defense response to bacterium decreased efficacy, abnormal dram1ibl53/ibl53 bacterial treatment by injection: Mycobacterium marinum Figure 3 with image from Xie et al., 2024
defense response to bacterium decreased efficacy, abnormal dram1ibl53/ibl53 bacterial treatment by injection: Mycobacterium marinum M Fig. S3 from Sommer et al., 2019
macrophage phagocytic vesicle increased amount, exacerbated dram1ibl53/ibl53 (AB/TL) chemical treatment by environment: bafilomycin A1 Fig. 3 with image from Zhang et al., 2020
defense response to bacterium disrupted, abnormal dram1ibl53/ibl53 (AB/TL) standard conditions Fig. 1 with image from Zhang et al., 2020
defense response to bacterium decreased efficacy, abnormal dram1ibl53/ibl53 (AB/TL) bacterial treatment by injection: Mycobacterium marinum Fig. 6 with image from Zhang et al., 2020
whole organism map1lc3b expression increased amount, abnormal dram1ibl53/ibl53 (AB/TL) bacterial treatment by injection: Mycobacterium marinum Fig. 3 with image from Zhang et al., 2020
whole organism ab4-sqstm1 labeling increased amount, abnormal dram1ibl53/ibl53 (AB/TL) chemical treatment by environment: bafilomycin A1 Fig. 3 with image from Zhang et al., 2020
macrophage pyroptotic inflammatory response increased occurrence, abnormal dram1ibl53/ibl53 (AB/TL) bacterial treatment by injection: Mycobacterium marinum Fig. 6 with image from Zhang et al., 2020
whole organism map1lc3b expression increased amount, abnormal dram1ibl53/ibl53 (AB/TL) chemical treatment by environment: bafilomycin A1 Fig. 3 with image from Zhang et al., 2020
whole organism ab2-optn labeling increased amount, abnormal dram1ibl53/ibl53 (AB/TL) chemical treatment by environment: bafilomycin A1 Fig. 3 with image from Zhang et al., 2020
macrophage phagocytosis decreased rate of occurrence, abnormal dram1ibl53/ibl53; ump2Tg bacterial treatment by injection: Mycobacterium marinum Fig. 5 with image from Zhang et al., 2020
defense response to bacterium disrupted, abnormal dram1ibl53/ibl53; ump2Tg bacterial treatment by injection: Mycobacterium marinum Fig. 5 with image from Zhang et al., 2020
defense response to bacterium decreased efficacy, ameliorated dram1ibl53/ibl53 + MO1-caspa (AB/TL) bacterial treatment by injection: Mycobacterium marinum Fig. 6 with image from Zhang et al., 2020
defense response to bacterium decreased efficacy, ameliorated dram1ibl53/ibl53 + MO4-gsdmeb (AB/TL) bacterial treatment by injection: Mycobacterium marinum Fig. 6 with image from Zhang et al., 2020
macrophage migration disrupted, abnormal dram1ibl53/ibl53; zf155Tg bacterial treatment by injection: Mycobacterium marinum Fig. 3 with image from Zhang et al., 2020
Citations