CRISPR

CRISPR1-nr3c2

ID
ZDB-CRISPR-190529-2
Name
CRISPR1-nr3c2
Previous Names
None
Target
Sequence
5' - GGAAACTGTACCCTCTTTGT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
ca402 nr3c2
Expression
Gene expression in Wild Types + CRISPR1-nr3c2
No data available
Phenotype
Phenotype resulting from CRISPR1-nr3c2
No data available
Phenotype of all Fish created by or utilizing CRISPR1-nr3c2
Phenotype Fish Conditions Figures
whole organism cortisol increased amount, abnormal nr3c2ca402/ca402 chemical treatment by environment: cortisol Fig. 1 from Faught et al., 2019
thigmotaxis process quality, ameliorated nr3c2ca402/ca402 chemical treatment by environment: cortisol Fig. 4 from Faught et al., 2018
whole organism hmgcs1 expression increased amount, abnormal nr3c2ca402/ca402 standard conditions Fig. 3 from Faught et al., 2019
whole organism nr3c1 expression increased amount, abnormal nr3c2ca402/ca402 control Fig. 2 from Faught et al., 2018
whole organism cholesterol increased amount, abnormal nr3c2ca402/ca402 chemical treatment by environment: cortisol Fig. 2 from Faught et al., 2019
whole organism triglyceride decreased amount, abnormal nr3c2ca402/ca402 chemical treatment by environment: cortisol Fig. 2 from Faught et al., 2019
whole organism hsd11b2 expression increased amount, abnormal nr3c2ca402/ca402 chemical treatment by environment: cortisol Fig. 1 from Faught et al., 2019
whole organism hsd11b2 expression increased amount, abnormal nr3c2ca402/ca402 control Fig. 2 from Faught et al., 2018
locomotory behavior increased process quality, abnormal nr3c2ca402/ca402 control Fig. 4 from Faught et al., 2018
whole organism elovl2 expression increased amount, abnormal nr3c2ca402/ca402 standard conditions Fig. 3 from Faught et al., 2019
whole organism fasn expression increased amount, abnormal nr3c2ca402/ca402 standard conditions Fig. 3 from Faught et al., 2019
whole organism fasn expression increased amount, abnormal nr3c2ca402/ca402 chemical treatment by environment: cortisol Fig. 3 from Faught et al., 2019
whole organism cortisol increased amount, abnormal nr3c2ca402/ca402 standard conditions Fig. 2 from Faught et al., 2018
whole organism pomca expression increased amount, abnormal nr3c2ca402/ca402 control Fig. 2 from Faught et al., 2018
whole organism cholesterol increased amount, abnormal nr3c2ca402/ca402 standard conditions Fig. 2 from Faught et al., 2019
whole organism pparg expression increased amount, abnormal nr3c2ca402/ca402 standard conditions Fig. 3 from Faught et al., 2019
whole organism nr3c2 expression increased amount, abnormal nr3c2ca402/ca402 control Fig. 2 from Faught et al., 2018
thigmotaxis decreased occurrence, abnormal nr3c2ca402/ca402 control Fig. 4 from Faught et al., 2018
locomotory behavior process quality, ameliorated nr3c2ca402/ca402 chemical treatment by environment: cortisol Fig. 4 from Faught et al., 2018
response to stress delayed, abnormal nr3c2ca402/ca402 stress Fig. 3 from Faught et al., 2018
whole organism lpla expression increased amount, abnormal nr3c2ca402/ca402 chemical treatment by environment: cortisol Fig. 4 from Faught et al., 2019
whole organism cortisol amount, abnormal nr3c2ca402/ca402 stress Fig. 3 from Faught et al., 2018
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.