CRISPR

CRISPR2-tfeb

ID

ZDB-CRISPR-190219-1

Name

CRISPR2-tfeb

Previous Names

None

Target

tfeb (1)

Sequence

5' - GGTGCACTGATGGCTGGCGT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
st120	tfeb
st121	tfeb

Expression

Gene expression in Wild Types + CRISPR2-tfeb

No data available

Phenotype

Phenotype resulting from CRISPR2-tfeb

No data available

Phenotype of all Fish created by or utilizing CRISPR2-tfeb

Phenotype	Fish	Conditions	Figures
oligodendrocyte cell body mbpa expression increased distribution, abnormal	tfeb^st120/+; tfeb^st121/+ (TL)	standard conditions	Fig. 4 from Meireles et al., 2018
oligodendrocyte cell body mbpa expression mislocalised, abnormal	tfeb^st120/+; tfeb^st121/+ (TL)	standard conditions	Fig. 4 from Meireles et al., 2018
spinal cord dorsal region has extra parts of type oligodendrocyte myelin sheath, abnormal	tfeb^st120/+; tfeb^st121/+ (TL)	standard conditions	Fig. 4 from Meireles et al., 2018
spinal cord central nervous system myelination increased occurrence, abnormal	tfeb^st120/+; tfeb^st121/+ (TL)	standard conditions	Fig. 4 from Meireles et al., 2018
midbrain microglial cell amount, ameliorated	rraga^st77/st77; tfeb^st120/+	standard conditions	Fig. 4 from Iyer et al., 2022
central nervous system oligodendrocyte mbpa expression amount, ameliorated	rraga^st77/st77; tfeb^st120/+ (TL)	standard conditions	Fig. 3 from Meireles et al., 2018
central nervous system oligodendrocyte mbpa expression amount, ameliorated	rraga^st77/st77; tfeb^st120/+; tfeb^st121/+ (TL)	standard conditions	Fig. 3 from Meireles et al., 2018
spinal cord central nervous system myelination occurrence, ameliorated	rraga^st77/st77; tfeb^st120/+; tfeb^st121/+ (TL)	standard conditions	Fig. 3 from Meireles et al., 2018
spinal cord ventral region has number of oligodendrocyte myelin sheath, ameliorated	rraga^st77/st77; tfeb^st120/+; tfeb^st121/+ (TL)	standard conditions	Fig. 3 from Meireles et al., 2018
midbrain microglial cell amount, ameliorated	rraga^st77/st77; tfeb^st120/st120	standard conditions	Fig. 4 from Iyer et al., 2022
midbrain microglial cell amount, ameliorated	tfe3b^st125/+; tfeb^st120/+; flcn^st127/st127	standard conditions	Fig. 5 from Iyer et al., 2022
microglial cell apoeb expression amount, ameliorated	tfe3b^st125/st125; tfeb^st120/st120; flcn^st127/st127	standard conditions	Fig. 5 from Iyer et al., 2022
midbrain microglial cell amount, ameliorated	tfe3b^st125/st125; tfeb^st120/st120; flcn^st127/st127	standard conditions	Fig. 5 from Iyer et al., 2022
microglial cell lysosomal lumen acidification normal occurrence, ameliorated	tfe3b^st125/st125; tfeb^st120/st120; flcn^st127/st127	standard conditions	Fig. 5 from Iyer et al., 2022
macrophage EGFP expression spatial pattern, ameliorated	tfe3b^st125/st125; tfeb^st120/st120; flcn^st127/st127; gl22Tg/gl22Tg	standard conditions	Fig. 5 from Iyer et al., 2022
microglial cell EGFP expression spatial pattern, ameliorated	tfe3b^st125/st125; tfeb^st120/st120; flcn^st127/st127; gl22Tg/gl22Tg	standard conditions	Fig. 5 from Iyer et al., 2022
midbrain microglial cell normal amount, ameliorated	rraga^st77/st77; tfe3a^st124/+; tfe3b^st125/+; tfeb^st120/+	standard conditions	Fig. 4 from Iyer et al., 2022

Citations