CRISPR

CRISPR1-gfi1b

ID

ZDB-CRISPR-190205-1

Name

CRISPR1-gfi1b

Previous Names

None

Target

gfi1b (1)

Sequence

5' - GGAGGAAACTCTGCCAGCTG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
qmc554	gfi1b
szy9	gfi1b

Expression

Gene expression in Wild Types + CRISPR1-gfi1b

No data available

Phenotype

Phenotype resulting from CRISPR1-gfi1b

No data available

Phenotype of all Fish created by or utilizing CRISPR1-gfi1b

Phenotype	Fish	Conditions	Figures
erythroblast gfi1aa expression increased amount, abnormal	gfi1b^{qmc554/qmc554}	standard conditions	Fig. 4 from Moore et al., 2018
posterior lateral mesoderm kdrl expression increased distribution, abnormal	gfi1aa^{qmc551Gt/qmc551Gt}; gfi1b^qmc554/+	standard conditions	Fig. 5 from Moore et al., 2018
intermediate cell mass of mesoderm slc4a1a expression decreased amount, abnormal	gfi1aa^{qmc551Gt/qmc551Gt}; gfi1b^qmc554/+	standard conditions	Fig. 6 from Moore et al., 2018
nucleate erythrocyte morphology, abnormal	gfi1aa^{qmc551Gt/qmc551Gt}; gfi1b^qmc554/+	standard conditions	Fig. 7 from Moore et al., 2018
erythroblast increased amount, abnormal	gfi1aa^{qmc551Gt/qmc551Gt}; gfi1b^qmc554/+	standard conditions	Fig. 7 from Moore et al., 2018
posterior lateral mesoderm kdrl expression increased distribution, abnormal	gfi1aa^{qmc551Gt/qmc551Gt}; gfi1b^{qmc554/qmc554}	standard conditions	Fig. 5 from Moore et al., 2018
erythroblast slc4a1a expression decreased amount, abnormal	gfi1aa^{qmc551Gt/qmc551Gt}; gfi1b^{qmc554/qmc554}	standard conditions	Fig. 7 from Moore et al., 2018
intermediate cell mass of mesoderm slc4a1a expression decreased amount, abnormal	gfi1aa^{qmc551Gt/qmc551Gt}; gfi1b^{qmc554/qmc554}	standard conditions	Fig. 6 from Moore et al., 2018
erythroblast zfp36l2 expression increased amount, abnormal	gfi1aa^{qmc551Gt/qmc551Gt}; gfi1b^{qmc554/qmc554}	standard conditions	Fig. 7 from Moore et al., 2018
erythroblast nucleus structure, abnormal	gfi1aa^{qmc551Gt/qmc551Gt}; gfi1b^{qmc554/qmc554}	standard conditions	Fig. 6 from Moore et al., 2018
nucleate erythrocyte morphology, abnormal	gfi1aa^{qmc551Gt/qmc551Gt}; gfi1b^{qmc554/qmc554}	standard conditions	Fig. 7 from Moore et al., 2018
erythroblast increased amount, abnormal	gfi1aa^{qmc551Gt/qmc551Gt}; gfi1b^{qmc554/qmc554}	standard conditions	Fig. 7 from Moore et al., 2018
nucleate erythrocyte nucleus morphology, abnormal	gfi1aa^{qmc551Gt/qmc551Gt}; gfi1b^{qmc554/qmc554}	standard conditions	Fig. 7 from Moore et al., 2018
erythroblast immature, abnormal	gfi1aa^{qmc551Gt/qmc551Gt}; gfi1b^{qmc554/qmc554}	standard conditions	Fig. 6 from Moore et al., 2018
erythroblast hemoglobin decreased amount, abnormal	gfi1aa^{qmc551Gt/qmc551Gt}; gfi1b^{qmc554/qmc554}	standard conditions	Fig. 6 from Moore et al., 2018
erythroblast etsrp expression increased amount, abnormal	gfi1aa^{qmc551Gt/qmc551Gt}; gfi1b^{qmc554/qmc554}	standard conditions	Fig. 7 from Moore et al., 2018
definitive erythrocyte differentiation decreased occurrence, abnormal	gfi1aa^{qmc551Gt/qmc551Gt}; gfi1b^{qmc554/qmc554}	standard conditions	Fig. 6 from Moore et al., 2018
endothelial cell hbbe1.1 expression absent, abnormal	gfi1aa^{qmc551Gt/qmc551Gt}; gfi1b^{qmc554/qmc554}	standard conditions	Fig. 7 from Moore et al., 2018
endothelial cell clec14a expression increased amount, abnormal	gfi1aa^szy5/szy5; gfi1b^szy9/szy9	standard conditions	FIGURE 2 from Wu et al., 2022
erythroid lineage cell sptb expression decreased amount, abnormal	gfi1aa^szy5/szy5; gfi1b^szy9/szy9	standard conditions	FIGURE 1 from Wu et al., 2022
endothelial cell sox7 expression increased amount, abnormal	gfi1aa^szy5/szy5; gfi1b^szy9/szy9	standard conditions	FIGURE 2 from Wu et al., 2022
endothelial cell cdh5 expression increased amount, abnormal	gfi1aa^szy5/szy5; gfi1b^szy9/szy9	standard conditions	FIGURE 2 from Wu et al., 2022
erythroid lineage cell epb41b expression decreased amount, abnormal	gfi1aa^szy5/szy5; gfi1b^szy9/szy9	standard conditions	FIGURE 1 from Wu et al., 2022
endothelial cell flt4 expression increased amount, abnormal	gfi1aa^szy5/szy5; gfi1b^szy9/szy9	standard conditions	FIGURE 2 from Wu et al., 2022
erythroid lineage cell alas2 expression decreased amount, abnormal	gfi1aa^szy5/szy5; gfi1b^szy9/szy9	standard conditions	FIGURE 1 from Wu et al., 2022
endothelial cell egfl7 expression increased amount, abnormal	gfi1aa^szy5/szy5; gfi1b^szy9/szy9	standard conditions	FIGURE 2 from Wu et al., 2022
erythroid lineage cell hbae3 expression decreased amount, abnormal	gfi1aa^szy5/szy5; gfi1b^szy9/szy9	standard conditions	FIGURE 1 from Wu et al., 2022
erythroid lineage cell hbbe3 expression decreased amount, abnormal	gfi1aa^szy5/szy5; gfi1b^szy9/szy9	standard conditions	FIGURE 1 from Wu et al., 2022
erythroid lineage cell tfr1a expression decreased amount, abnormal	gfi1aa^szy5/szy5; gfi1b^szy9/szy9	standard conditions	FIGURE 1 from Wu et al., 2022
erythroid lineage cell epb41b expression decreased amount, abnormal	gfi1aa^szy5/szy5; gfi1ab^szy10/szy10; gfi1b^szy9/szy9	standard conditions	FIGURE 1 from Wu et al., 2022
endothelial cell flt4 expression increased amount, abnormal	gfi1aa^szy5/szy5; gfi1ab^szy10/szy10; gfi1b^szy9/szy9	standard conditions	FIGURE 2 from Wu et al., 2022
erythroid lineage cell sptb expression decreased amount, abnormal	gfi1aa^szy5/szy5; gfi1ab^szy10/szy10; gfi1b^szy9/szy9	standard conditions	FIGURE 1 from Wu et al., 2022
endothelial cell cdh5 expression increased amount, abnormal	gfi1aa^szy5/szy5; gfi1ab^szy10/szy10; gfi1b^szy9/szy9	standard conditions	FIGURE 2 from Wu et al., 2022
erythroid lineage cell tfr1a expression decreased amount, abnormal	gfi1aa^szy5/szy5; gfi1ab^szy10/szy10; gfi1b^szy9/szy9	standard conditions	FIGURE 1 from Wu et al., 2022
erythroid lineage cell alas2 expression decreased amount, abnormal	gfi1aa^szy5/szy5; gfi1ab^szy10/szy10; gfi1b^szy9/szy9	standard conditions	FIGURE 1 from Wu et al., 2022
erythroid lineage cell hbbe3 expression decreased amount, abnormal	gfi1aa^szy5/szy5; gfi1ab^szy10/szy10; gfi1b^szy9/szy9	standard conditions	FIGURE 1 from Wu et al., 2022
erythroid lineage cell hbae3 expression decreased amount, abnormal	gfi1aa^szy5/szy5; gfi1ab^szy10/szy10; gfi1b^szy9/szy9	standard conditions	FIGURE 1 from Wu et al., 2022
endothelial cell clec14a expression increased amount, abnormal	gfi1aa^szy5/szy5; gfi1ab^szy10/szy10; gfi1b^szy9/szy9	standard conditions	FIGURE 2 from Wu et al., 2022
endothelial cell egfl7 expression increased amount, abnormal	gfi1aa^szy5/szy5; gfi1ab^szy10/szy10; gfi1b^szy9/szy9	standard conditions	FIGURE 2 from Wu et al., 2022
endothelial cell sox7 expression increased amount, abnormal	gfi1aa^szy5/szy5; gfi1ab^szy10/szy10; gfi1b^szy9/szy9	standard conditions	FIGURE 2 from Wu et al., 2022

Citations